Q: adaptive immune response
A: Immunity : The ability of the host to fight against the disease causing organism i.e., pathogen…
Q: Also answer Location number where correspond the 3 end of mRNA from this gene ans where u would find…
A: Exons are nucleic acid coding sequences that can be found in mRNA. Non-coding segments in DNA are…
Q: 6. a) What is meant by the term "symbiosis"? [K/U] b) Give an example for each type of symbiosis and…
A: Animals breathe in oxygen and exhale carbon dioxide during the process of respiration. Plants, on…
Q: Give the economic and ecological importance of Bamboo (the subfamily Bambusoideae).
A: Bamboos are a diverse group of evergreen perennial flowering plants in the subfamily Bambusoideae of…
Q: Why would vaccination be more likely to eradicate a viral disease than a bacterial disease? Why can…
A: The last case of Smallpox happened in 1977. Edward Jenner first introduced vaccine of Small pox.…
Q: Ant species work together to collect food and build the mounds they live within. This behavior…
A: Ants are distributed in all different habitats and everywhere on the planet but less in Antarctica,…
Q: Differentiate flexion from torsion. Why do these events occur in the developing embryo?
A: Answer--
Q: hoose the letter of the correct answer. Please answer it both. 1. Which of these is the major…
A: The process of creating offspring which are physiologically or biologically identical to the parent…
Q: Choose the answer that best describes Allopatric Speciation. evolution that occurs when populations…
A: Allopatric speciation occurs when a population becomes isolated from those other populations due to…
Q: Match the letter to the appropriate bone. Im A d Im
A: Introduction:- The core framework of body is the skeletal system.It is composed of bones as well as…
Q: The first step in the formation of urine is formation of filtrate that accumulates in Bowman's…
A: The renal system's primary activities include the management of ECF volume and blood pressure, the…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: The neurons are the basic functional unit of the nervous system in our body. Neurons can receive the…
Q: AN
A: Male toad
Q: What is the pH of blood? The pH Scale Ammonia Stomach Acid Vinegar Coffee Water Baking Soda Solution…
A: pH is the measure of how acidic or basic a liquid is. Range of pH scale is 0-14. <7 being the…
Q: Direction: Explain the following in paragraph form consists of at least five sentences Stomates…
A: The evaporation of water in the form of water vapour through the stomata is called transpiration.…
Q: 1. For the complete metabolism of 2 glyceraldehyde 3-phosphate molecules through glycolysis,…
A: Glycolysis is the process in which one mole of glucose is partially oxidized into two moles of…
Q: STUDY QUESTIONS 1. List down at least 3 differences in the anatomy of male and female frogs. 2. How…
A: Frogs are amphibians and humans are mammals.
Q: Differentiate concentrates from roughages and compare its utilization in animal feeding.
A: Animal nutrition is critical for animal health and welfare, as well as the production of safe and…
Q: 8. Describe the MAP kinase activation pathway
A: Protein kinases and other messenger systems form highly interactive networks to achieve the…
Q: s it possible to stop animal testing?
A: The use of animals other than humans in experiments for study and research is referred to as animal…
Q: Question 1) Answer yes or no to the following questions. Scenario (A) A researcher uses a model from…
A: A. Viable population is capable to maintain itself and able to survive in opposite conditions.…
Q: Helping tags: Biology, microbiology, Vibrio spp. It's a common practice in some countries to eat…
A: Oyster refers to a group of salt-water bivalve molluscs that dwell in marine or brackish…
Q: what is the difference between DNA microarray and Fluorescence in situ technique? or is the…
A: Difference between FISH and Microarray Technique Fluorescence In Situ Hybridization It is possible…
Q: Describe how presynaptic targets can be regulated to affect neurotransmitter release at the…
A: Synapse, also known as neuronal junction is the site of transmission of electric nerve impulses…
Q: The name of the person who has autism, is an expert on the condition and has written about how…
A: Science and technology have advanced to the point that we can now determine the origins, signs, and…
Q: The classification of living organisms is a job that cannot be done by one individual and can never…
A: classification of organism -Each organism is different from all others to a lesser or greater…
Q: Which of the following regarding aldosterone is false? the process leading to its release begin with…
A: The option 1 is correct as renin begins the cleavage of angiotensinogen to form angiotensin II. This…
Q: Explain what impact a blocked gall bladder duct would have on digestion.
A: Introduction Gallbladder:- It is a small, pear-shaped organ on the right side of your abdomen, just…
Q: 5) cranial nerve II, the optic nerve sends nerve impulses to the brain carrying information about…
A: It is critical to learn and know the anatomy and physiology of the human body. Many changes in the…
Q: Capacity to carry oxygen by sickle cell hemoglobin is reduced due to
A: Sickle cell disease is a group of disorders of blood generally inherited from parents to their…
Q: This is about ecological sampling methods in estimating plant cover. Define the following: cover,…
A: Plant cover in ecology is used to measure the abundance of plant species in a relative area covered…
Q: The Bax gene, codes for a cytosolic protein that plays an important role in apoptosis. Growth factor…
A: Bax gene Bcl-2-associated X protein which is pro-apoptotic member of the Bcl-2 gene family.
Q: Give economic and ecological significance of Wheat species (Triticum).
A: Introduction Wheat is a grass that is commonly farmed for its seed, a cereal grain that is a staple…
Q: intensity €495 1295 567.5 567.9 1995 s
A: M/z means mass to charge ratio . The first step is involves selecting largest leaks in mass spectrum…
Q: What are the principle and basic concepts of Simple staining
A: The simple staining doesn't give a lot of data about the cell separated from the bacteria'…
Q: How can a person reduce their own food waste? O Use clean energy in food production facilities and…
A: Only buy food if you have a limited supply.Don't overcook your food.Refrigeration is a good way to…
Q: Leo was taking angiotensin converting enzymes inhibitor or what is known as ACE inhibitor; this…
A: The renin–angiotensin–aldosterone system (RAAS) is a critical regulator of blood volume and systemic…
Q: both complex I and complex II send electrons to cytochrome c, how many cytochrome c molecules will…
A: Electrons from Nadh pass through a flavoprotein to a series of iron sulphur proteins in complex I to…
Q: Complete the table. Calculate the size of a theoretical population of E. Coli, if given unlimited…
A: The generation time of the given bacteria Escherichia coli is 20 minutes. This means that every 20…
Q: For your 25ul ligation reaction: You need to add 160ng of your digested insert DNA (which is at a…
A: Given: Total volume - 25ul. The DNA need to be added is 160 ng. One ul contains 160 ng of digested…
Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…
A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…
Q: Most have well defined 3' ends terminating in poly(A) tails of - 200 nt. A prokaryotic mRNAs B…
A: The 3' ends of RNA transcripts synthesised by RNA polymerase II are produced bynthe endolytic…
Q: Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT
A:
Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…
A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…
Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…
A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…
Q: Most inherited forms of cancer involve _______________ and these individuals are for the mutation.…
A: Firstly we can examine what each of the terms given represents. 1. Tumor suppressor gene: It is a…
Q: In most populations, population size remain near the carrying capacity as long as limiting factors…
A: Limiting resources are considered as the carrying capacity for any population.
Q: A sealed greenhouse that allows sunlight through the windows but prevents water or vegetation from…
A: A greenhouse is a self-designed structure having walls and roofs made up of transparent materials…
Q: give an example of creation myths in the philippines stories
A: Introduction Philippine mythology is a collection of stories and epics derived from and incorporated…
Q: Are cosmetics still being tested on animals? Show proof that the practice is still going on or has…
A: Introduction Cosmetic animal tests are archaic chemical-poisoning experiments devised more than half…
Give economic and ecological significance of Rye (Secale)
Step by step
Solved in 3 steps
- Write the botanical name along with their families of the following plants and give shorts account on their economic importance of the different useful part. 1 ) Sassi 2 ) Sunflower 3 ) Bamboo 4 ) Sarpagandha 5 ) TurmericDescribe the composition of humus and its importance in soil.SPECIMEN BASE TIP OUTLINE MARGIN VENATION LEAF SURFACE Allium cepa . Musa sp Euphorbia pulcherrima Aloe vera Nepenthes sp. Citrus microcarpa Bougainvillea spectabilis Opuntia sp. Bryophyllum pinnatum Eichhornia crassipes Mussaenda sp. Pisum sativum Asparagus sp.
- Find information about this herb and provide interesting facts about it and its use in veterinary medicine: *Name: Bai Zhi *Scientific name: Angelica dahurica *Common name: Angelica rootWhat part of the source plant is used to make Aloe?. Give an Outline of the cultivation of Sugar-Cane in any named Caribbean Country Guyana