Please answer asap and type your answer and do not copy from anywhere please ? At which level of the trophic food pyramid below should we expectthe most concentrated accumulation of toxins (such as mercuryor PCB's)?TOP CARNIVORESe.g. shárk, dolphin, albatrossHEATENERGYLOSS3rd LEVELCARNIVOROUS CONSUMERSe.g. squid2nd LEVELCARNIVOROUS CONSUMERSe.g. larger fish.DECOMPOSERS1ST LEVEL CARNIVOROUS CONSUMERSe.g. juvenile stages of fish and jellyfishas well as small fish, crustaceans and sea stars2HERBIVOROUS CONSUMERSe.g. zooplankton, cocklesSUN'SENERGYPRIMARY PRODUCERSe.g. phytoplankton, seaweedOThe University of Waikato Te Where Wananga o Wakato www.scienceleam.org.nzO A. Primary producersO B. Herbivorous consumersO C. 1st level carnivorous consumersD. 2nd level carnivorous consumersO E. 3rd level carnivorous consumersO F. Top CarnivoresTROPHIC LEVEL

A food pyramid is a diagrammatic representation of the feeding structure of organisms in a…

Answered: E. Top Carnivores

Science

Biology

E. Top Carnivores

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter54: Ecosystems And Global Change

Section: Chapter Questions

Problem 9TYK: The amount of energy available at the highest trophic level in an ecosystem is determined by: a....

See similar textbooks

Related questions

Q: are produced. If the blue-eyed sheep are mated with cach other, what percent of their offspring will…

A: In the first example incomplete dominance is shown where dominant trait is not completely expressed…

Q: Patch clamping is a technique to record the electrical potential or to measure currents generated by…

A: Tetrodotoxin is an extremely robust poison (toxin) discovered in particular within the liver and sex…

Q: Exercise 4. Make a comparative description of curariform pipecuronium bromide and suxamethonia.…

A: Both of these drugs are used in neuromuscular block during various procedures medically or even to…

Q: On the skin, Propionibacterium acnes converts lipids secreted by the oil glands to unsaturated fatty…

A: Propionibacterium acnes is a ubiquitous, slow growing, rod-shaped, non-spore forming, Gram-positive…

Q: Several set of terms are used to indicate the direction and position when describing the relative…

A: Anatomical directional terms are the terms used to evaluate the particular positioning , location ,…

Q: 20.Which of the following contain cells that facilitate the secondary growth or the growth in…

A: Question : 20. Which of the following contain cells that facilitate the secondary growth or the…

Q: 26. In sheep, eye color is controlled by a single gene with two alleles. When a homozygous…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: Evidence exists that a catastrophic collision between Earth and a large extraterrestrial body…

A: Mass extinction is the extinction of a large number of species over a short duration of time due to…

Q: What are the immunological implications of 'bare lymphocyte syndrome' /MHC deficiency?

A: Cell immunity

Q: Discuss "The respiratory pathway is an amphibolic pathway."

A: Introduction In this question we will discuss about " the respiratory pathway is an an amphibolic…

Q: During phase I, venous return occurs and blood enters relaxed atria. The pressure in the veins is…

A: Aorta carries oxygenated blood to different parts of body and pulmonary arteries carry deoxygenated…

Q: During the Early _______________, life consisted of prokaryotic cells, but by the end of this…

A: The major evolution evens since the origin of the earth have been categorized into three major eras.

Q: How many copies of a protein need to be present in a cell in order for it to be visible as a band on…

A: * Given that you can load 100 µg of cell extract onto a gel and can detect 10 ng in a single band by…

Q: What do you understand by photoperiodism and vernalisation? Describe their significance.

A: Photoperiodism is the term used to describe the response of plants to the length of time that they…

Q: Why can alcohol kill bacteria? Explain via proteins.

A: Alcohol kills bacteria through The process called as denaturation. Denaturation takes place when…

Q: What is the mesentery? Why is it now being considered the 79th organ of the body

A: The “new” organ is called the mesentery, and absolutely everyone’s digestive tract has one. The…

Q: Under what circumstances could nonhomologous endjoining be said to be error prone?

A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…

Q: what is the function of Sodium dichlorophenolindophenol with relation to vitamin c?

A: Vitamin c is made up of a chemical called ascorbic acid with the C6H8O6 as the molecular formula.…

Q: When animals oxidize stored fat, they produce metabolic water.Even though the production of…

A: Introduction Metabolism is a term that is used to describe all chemical reactions involved in…

Q: List a few examples of cellular work. e. Where does the energy to make ATP come from? It doesn't…

A: 4 a. Exothermic,catabolic,G <0 The sign of ΔG for a reaction that is exothermic (ΔH is -ve) and…

Q: explain how bacteria can be manipulated to contain a foreign DNA sequence or gene, how the…

A: Plasmid or vector transformation is the process by which exogenous DNA is transferred into the host…

Q: Look at leaves of the same plant on the shady side and compare it with the leaves on the sunny side.…

A: Photosynthesis is limited by the availability of light. When the leaves are in the shade, they…

Q: Consider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant…

A: Introduction A mutation occurs when the sequence of DNA changes. Mutations can occur as a result of…

Q: By base-pair substitution, what are all the synonymouschanges that can be made starting with the…

A: The example of CGG is RNA codon which transiently binds with the transfer RNA by simple base pairing…

Q: -35 sequence Pribnow box 5' GATTCCGTATTACAGCATAGGCTATATTCACGTGGTACGCTA 3' 3'…

Q: The “big portion of the brain” that the narrator highlights first is the

A: Answer :- As we know that big portion of the brain is called cerebrum. And , The cerebrum is the…

Q: Even though a very few cells in a C4 plant carry out the biosynthetic - Calvin pathway, yet they are…

A: Introduction We will answer this question in below step.

Q: What are the assumptions made during the calculation of net gain of ATP?

A: Several assumptions are made in order to perform theoretical calculations on ATP molecules, the most…

Q: Ap Normal No Spacing Head 目三。、田 Paragraph Styles 1. You heve a circuler plasmid (pUC57), which…

A: We are allowed to do one or upto three subpart of a question. Please repost the undone question…

Q: Q4.8. Which statement below is TRUE about the voltage-gated Na* channels during the action…

Q: The optometrist asked Garreth Bale to close his right eye and focus on the tip of his pen while she…

A: ANSWER) (3) accomodation and convergence As the Greth Bale is not comfortable when the optometrist…

Q: discuss the relative advantages and disadvantages of light and electron microscopy. how could you…

A: A microscope is a device used to observe microscopic organisms that are invisible to the naked eye.…

Q: importance of plasma proteins

A: Plasma proteins These are blood proteins or the proteins present in the bloodstream. They are of…

Q: Table 1: Characteristics of DNA Questions To what maior group of biomolecules does DNA belong? wers…

A: INTRODUCTION DNA Deoxyribonucleic acid is the heriditary material present in humans and other…

Q: Explain what is diversity and how is this important in an ecosystem.

A: Biodiversity is defined as variability among living organisms, diversity within species, ecosystems,…

Q: Consider the three calcium-binding proteins - Calmodulin, T roponin C and Calbindin Dok: a. What are…

A: * calmodulin is of low molecular weight and it is acidic and calcium binding protein mediates the…

Q: Some species of animals gain physiological advantages byexploiting the specialized physiological…

A: Mammals are usually defined in the way that they are a group that includes humans—are warm-blooded…

Q: There are two variants of the enhancer sequence found in people. One has the sequence CACTAAAG, and…

A: Regulatory sequences or elements are the DNA sequences that serve as a binding site for regulatory…

Q: What is meant by 'B lymphocytes are sensitive to clonal deletion'?

A: Immunity

Q: Phenotype Genotype Temperature-sensitive allele Barr Body Dimorphism Cytoplasmic segregation Sum…

A: Genetics is the investigation of genes and heredity-of how certain characteristics or attributes…

Q: Question 7. What is the sequence of the primary transcript produced from this gene? -35 sequence…

A: A gene is a stretch of DNA that codes for a polypeptide chain and is transcribed into mRNA.

Q: The first step leading to allopatric speciation is (a) hybrid inviability(b) hybrid breakdown (c)…

A: Speciations are the process in which species evolve into something so drastically different than…

Q: How many links long are MOST food chains? O 2 links or fewer O 5 links or fewer 8 links for fewer O…

A: Food chain It is the linear representation of links of food starting from producer.

Q: By now you should be familiar with the following cellular components. Briefly define what they are…

A: Hi! Thank you for the question. As per the conduct code we will answer only the first three parts.…

Q: how are SDS-PAGE and BN-PAGE techniques used determine the composition of protein-photosynthetic…

A: PAGE OR the polyacrylamide gel electrophoresis is a kind of molecular technique that involves the…

Q: A woman with B type blood gives birth to a baby with O type blood. Which of the following men could…

A: The ABO blood group system is determined by multiple allelism. The presence of specific antigen on…

Q: heterosis and the trait classification of animals

A: The trait is a remarkable characteristic of quality exhibited by an organism. Heterosis is the…

Q: One of your classmates is planning to study endocytosis at neuronal synapses for their senior…

A: Introduction Endocytosis is the process by which the flexibility of the cell membrane enables the…

Q: The brain stem also includes the bulb-like

A: The swollen part of the central nervous system located in brainbox having cavities filled with…

Q: Why do we consider blood as a connective tissue?

A: Extracellular matrix (ECM) connective tissues contain cells that are dispersed throughout the…

Concept explainers

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.

Question

Please answer asap and type your answer and do not copy from anywhere please ?

At which level of the trophic food pyramid below should we expect
the most concentrated accumulation of toxins (such as mercury
or PCB's)?
TOP CARNIVORES
e.g. shárk, dolphin, albatross
HEAT
ENERGY
LOSS
3rd LEVEL
CARNIVOROUS CONSUMERS
e.g. squid
2nd LEVEL
CARNIVOROUS CONSUMERS
e.g. larger fish.
DECOMPOSERS
1ST LEVEL CARNIVOROUS CONSUMERS
e.g. juvenile stages of fish and jellyfish
as well as small fish, crustaceans and sea stars
2
HERBIVOROUS CONSUMERS
e.g. zooplankton, cockles
SUN'S
ENERGY
PRIMARY PRODUCERS
e.g. phytoplankton, seaweed
OThe University of Waikato Te Where Wananga o Wakato www.scienceleam.org.nz
O A. Primary producers
O B. Herbivorous consumers
O C. 1st level carnivorous consumers
D. 2nd level carnivorous consumers
O E. 3rd level carnivorous consumers
O F. Top Carnivores
TROPHIC LEVEL

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The overexploitation of cod in the North Atlantic releases crab and shrimp from predation pressure and results in a boom in the number of crab and shrimp. The increased number of crab and shrimp cause a decline in zooplankton abundance, which subsequently causes an increase in phytoplankton abundance. This change in the food web is an example of which of these? top-down control bottom-up control O behavioral cascade O trophic ricochet O donor-control
A Food Web om Eage Pythan Wolf Rat Dragonfly Thrush Frog Butterfly Fruit Fly Grasshopper Mangoes Corn A Flowering Plant Lavenders Look at the food web above to answer the following questions. 1. Which organisms are the producers in this food web? 2. Which organism is an example of a primary consumer? 3. Which organism is an example of a tertiary consumer?
Why are food chains relatively short? O Not enough energy is transferred from one trophic level to the next to support a longer chain. O There are not enough species of carnivores to make the food chain longer. O Longer food chains require more land that is found in today's fragmented habitats. There aren't enough different plant species to support enough herbivore species to support the number of carnivore species needed for longer food chains.
Carnivoresthat feed on herbivores (or on detritivores) are referred to as:a.primary producers.b.primary consumers.c.secondary consumers.d.parasitoids.
The amount of energy available at the highest trophic level in an ecosystem is determined by: a. only the gross primary productivity of the ecosystem. b. only the net primary productivity of the ecosystem. c. the gross primary productivity and the standing crop biomass. d. the net primary productivity and the ecological efficiencies of herbivores. e. the net primary productivity and the ecological efficiencies at all lower trophic levels.
The loss of an apex consumer would impact which trophic level of a food web? primary producers primary consumers secondary consumers all of the above
A limiting resource does all the following except that it (a) tends to restrict the ecological niche of a species (b) is in short supply relative to a species need for it (c) limits the presence of a species in a given community (d) results in an intermediate disturbance (e) may be limiting for only part of an organisms life cycle
Organisms at the first trophic level ________. a. capture energy from a nonliving source b. are eaten by organisms at lower trophic levels c. are shown at the top of an energy pyramid d. are consumers
At which trophic level would you expect to find the highest concentration of a biomagnifying toxin? O primary producer herbivore mesopredator top carnivore primary consumer
1. Examine the food webs for Lake Victoria, East Africa (fig 31.2 a,b) before and after the introduction of the Nile perch (Leveque 1995). Calculate the mean food chain length, percent of trophic groups at various levels, and connectance for each food web. Oreochromis Insectivorous Fish Chironomids Chaoborous Man Piscivorous Fish Zooplanktivorous Haplochromines Rastrineobola Zooplankton Detritus/Phytoplankton Lake Victoria in the 1970s Detritivorous Phytoplanktivorous Haplochromines Figure 31.2. (a) Food web structure of Lake Victoria before introduction of the Nile Perch. [continued on next page) Molluscivorous Fish Molluscs
This trophic level includes carnivores that eat herbivores Tertiary consumer Primary consumer Primary producer Secondary consumer
Raccoons Ducks Fish + Minnows Aquatic crustaceans Algae and floating plants O A. Raccoons, fish and ducks are secondary consumers O B. Minnows and fish are primary consumers O C. Aquatic crustaceans are omniyores