Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…
A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…
Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…
A: The sequence of protein is usually notated as a string of letters, according to the order of the…
Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…
Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…
A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…
Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC By in vitro translating the mRNA, you…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: The gene ABCD is 1500 bases long. Answer the following questions: What would be the likely…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: what is c-abl mRNA
A: An mRNA is the RNA encoded from a stretch of DNA template strand to serve as a template for the…
Q: CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?
A: The sequence of a protein is usually notated as a string of letters, according to the order of the…
Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…
A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…
Q: The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb.…
A: Because the gene contains introns (non-coding regions within the gene) that are removed during the…
Q: What's the mRNA sequence for TACATCTTGGCGACGACT
A: mRNA is a single-stranded RNA that developed during the transcription in a cell. This is also known…
Q: In which reading frame will this mRNA be read? 5'- ACAG C C U G CA A GU C A CU GACG- 3' O 1st O 2nd…
A: The order of amino acids in a protein from the N-terminus to the C-terminus is specified by mRNA…
Q: Name and explain the process by which mRNA is formed.
A: Gene expression is the process by which information which is contained in genes is decoded to…
Q: In which reading frame will this mRNA be read? 5’- A C A G A U G C A A G U C U A A U G A C G - 3’…
A: Ans- b ) 2nd This mRNA will be read in the 2nd reading frame.
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: what is Fused bcr/c-abl mRNA
A: Fused bcr/c-abl is a result of balanced translocation between chromosome 9; 22. Translocation is a…
Q: For what silencing of mRNA has been used?
A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…
Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…
A: Gene expression includes transcription and translation. It leads to synthesize mRNA and protein…
Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…
A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…
Q: Complete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and…
A: FGF3 gene is responsible for producing a protein called fibroblast growth factor 3 which is a part…
Q: Determine the amino acid sequence for a polypeptide coded for by the following mRNA transcript…
A: The sequence of three RNA or DNA nucleotides that corresponds to a particular amino acid or stop…
Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…
Q: Provide the abbreviation for the amino acid sequence expected from the following MRNA segment using…
A: Following amino acid sequence is predicted.
Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…
A: Translation Process by which the mRNA codes for a particular protein is known as translation.
Q: What is the isoelectric point of this fragment? DHVTHLRKMG
A: Here the given peptide is: DHVTHLRKMG…
Q: Consider the mRNA sequence below. Assume that the following MRNA segment has been translated.…
A: Genetics is the branch of biology that deals with the study of genes, their variation, and heredity…
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…
A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…
Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…
A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…
Q: How many amino acid are in each of the two polypeptides produced? And how many nucleotides long…
A: The amino acids are produced by the DNA (deoxyribonucleic acid) through processes called…
Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Assuming that each nucleotide is 0.34 nm long in mRNA, howmany triplet codes can simultaneously…
A: Nucleotide : It is an organic molecule that is the building block of DNA and RNA. They also have…
Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?
A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…
Q: UGGGCUGGUGCCGAGAAAGUUAGGUAA-3' What is the name of the sixth amino acid in the protein formed from…
A:
Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…
A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.
Q: TGTACACATGTCCGAAACAGACTTACCGAA-5
A: For the given DNA Sequence , the translated mRNA is as follows_ 3'TGTACACATGTCCGAAACAGACTTACCGAA5'…
Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…
A: Translation is the process during which codons in mRNA are identified by tRNA with specific…
Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…
A: Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…
Q: a) Examine the nudeotide sequence below, and determine the amino acid sequence encoded by this mRNA.…
A: a) The nucleotide and translated mRNA and amino acid sequences are given below: GGA GGC CTG GCC TAC…
Q: Please solve and answer in complete sentences. (thank you) Sequence divergence vs conservation for…
A: The exons are the type of sequences that are utilized after the processing of the mRNA is complete.…
Q: summarize these results using concise language in a neat table; Control : 5’…
A: There are different types of mutations based on the changes in DNA sequences. It includes missense,…
Q: What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300…
A: To determine: To determine the required minimum length of an mRNA that is coded for a protein of 300…
Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…
A: Introduction DNA and RNA are the main genetic material found in all the species irrespective of…
Q: What is the correct amino acid sequence for the mRNA code AUGCCAGUAUGA answer choices A.…
A: Introduction: Amino acids are biomolecules that contain two functional groups that are amine and…
Q: Is the shorter length of the mature mRNA a good thing or a bad thing?
A: RNA is the nucleic acids similar to the DNA and contains uracil instead of the thymine. It plays…
Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…
A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…
Does crude mRNA have density? if so what is the density value ? Thank You
Step by step
Solved in 2 steps
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.CCGGTGTACACAGGGACCATTCGATTA What is the mRNA:? Protein Phenotype?TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
- The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the use of UAUC incorporates four amino acids. Why?What are the functional consequences of this deletion for lilP mRNA transcription and translation? (100 words max.)If the mRNA sequence is ATG GGG AGC What is the anticodon sequence?
- Consider the following mature mRNA from a human cell: 5' UAAUGUCGCAAUAACC 3¹ What is the sequence of amino acids in the translated protein? Second letter A First letter С U d A G บบบ UUC P U UUA UUG Leu CUU CUC CUA CUG GUU GUC GUA GUG -Phe Met-Ser-Gln Met-Arg-Lys-Ser Leu Stop-Cys-Arg-Asn-Asn C AUU AUC lle AUA ACA AUG Met ACG Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC GCU GCC GCA GCGJ Ser Pro Thr Ala UAU UAC Tyr UGU UGC. UAA Stop UGA Stop UAG Stop UGG Trp CAC CAGGin CAU His Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. AAU Asn AAA Lys AAG. There is no start codon, resulting in no translated protein. GAU ASP GAC Glu GAA GAG G CGU CGC CGA CGG Cys AGU AGC AGA AGG Arg GGU GGC GGA GGGJ Arg ser Gly MCAG U UCAG с А SCAG U SCAG U Third letterComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acid63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a 5' UAUGGC 3' 3' AUACCG 3' 5' GCCAUA 3' 3' GCCAUA 5 身
- 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this geneWhy mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of this difference?Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?