These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin found in people with Sickle-Cell Anemia. On the first line below the sequence, translate each strand into its MRNA. On the second line below the sequence, use the codon chart to translate the MRNA into amino acids. Wild-Type Hemoglobin: AT GG T G C A C C T G A CT C C T GA GG A G Mutant (Sickle-Cell) Hemoglobin: AT GG T G C A C C T G ACT C C T GT G G A G Where is the mutation? (Circle/highlight it above)

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made in the…

A: Quality transformations include adjustment in the construction of qualities which changes or alters…

Q: The drug, erythropoietin (EPO) is an artificial version of a protein that is naturally produced by…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: What type of molecule contains the site where amino acids link together to make a polypeptide? a.…

A: Translation is a process of protein synthesis from an mRNA sequence. It occurs in the ribosomal…

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: Red blood corpuscles (RBC) are the cells that carry oxygen thorough out the body. They are small…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The central dogma of life can be stated as follows: Replication of DNA to form new copies of DNA…

Q: Sickle cell hemoglobin DNA CACG T AGACTGAGGA CAC Sickle cell hemoglobin MRNA ickle cell hemoglobin…

A: According to the question, we have to mention the type of mutation present in Sickle cell anemia…

Q: The coding strand of DNA in a segment of a gene is as follows:ATG GGC CTT AGC. This strand carries…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: The sequence below is an mRNA strand that is in the cytoplasm ready to translated by a ribosome. If…

A: Translation is the process of formation of a protein chain from a RNA chain. Translation requires an…

Q: Sickle cell anemia occurs due to a point mutation in a gene for hemoglobin protein. This mutation…

A: Sickle cell anemia occurs due to point mutation in a gene for hemoglobin. Its symptoms are - fatigue…

Q: You may wish to consult the genetic code above to answer the following question. A mutation has…

A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…

Q: Refer to the partial gene sequence of DNA nucleotide bases listed below, and the genetic code chart…

A: The series of mechanism by which a DNA sequence is is transcribed into RNA, and mRNA is translated…

Q: The amino acids, in one-letter symbols and no spaces, coded by the following mRNA sequence is 5’…

A:

Q: Cystic Fibrosis is a genetically heritable disease caused by the loss of the chloride channel, CFTR.…

A: Cystic fibrosis is a genetic disease that is characterized by the production of excessively thick…

Q: (a.) When a mutation occurs to the given sequence of DNA, it will be; 5' CTATAAGGCGCAAATTCCTGCCAT…

A: Introduction :- Mutations are the hereditary changes that occurs in the Genetic material (DNA) of…

Q: Pick the most complete list of mRNA sequences that translate into Ser.   Question 3 options:…

A: According to the question, we have to find out the option which is the most complete list of mRNA…

Q: Which of the following MRNA sequences codes for the polypeptide sequence tyrosine-leucine-alanine?…

A: The mRNA is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene.…

Q: The coding strand of DNA in a segment of a gene is as follows: ATG GGC CTT AGC. This strand carries…

A: The DNA (deoxyribonucleic acid) duplex consists of a non-template and a template strand. The…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: The following gene sequence of nucleotides is found on the template (non-coding) strand of a…

A: The sequence would be opposite to template strand and similar to coding strand(except the thiamine…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg- tyr.…

A: The translation is a process where a mature mRNA sequence is converted into respective amino acids…

Q: The first column of the table below shows the beginning of a gene and five different mutations of…

A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…

Q: Which of the following mRNA codons could be changed to a stop codon by a single base pair…

A: A codon consists of three-nucleotides (A, G, C, or U) of RNA and carries the genetic information.…

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…

A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…

Q: Which of the following is a true statement concerning RNA? Group of answer choices a. mRNA is single…

A: The RNA or ribonucleic acid is a nucleic acid polymer that it is produced from the DNA by the…

Q: Which of the following statements about codons in prokaryotic cells and eukaryotic cells is correct?…

A: Option D is correct.

Q: Compare the two DNA sequences shown below and consider the single nucleotide mutation made In the…

A: Gene mutations involve alteration in the structure of genes which alters or modifies the structure…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: Mutations in the DNA molecule are caused by a spontaneous alteration. After a synonym mutation, the…

Q: If the following changes occurred in the gene, identify the type of mutation and how it would affect…

A: Codon is a triple of nucleotide base pair. Any change in the sequence resulting in altered phenotype…

Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…

A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…

Q: A gene is a piece of DNA that codes for a protein.  Genes are transcribed into mRNA and are on the…

A: Sometimes mutation disrupts protein synthesis by substitution, deletion, or insertion of one or more…

Q: Which of the following mutations would be most likely to have the most negative effect on the…

A: Translation is the process of synthesis of protein in the cytoplasm.

Q: In the following table, below each DNA nucleotide, type in the complementary mRNA nucleotides. Then,…

A: Introduction : The genetic code is the set of rules by which information encoded within genetic…

Q: Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6…

A: Proteins are synthesized from mRNAs through translation. mRNAs are synthesized through…

Q: A gene is a piece of DNA that codes for a protein. Genes are transcribed into MRNA and are on the…

A: The fundamental physical and functional unit of heredity is the gene. DNA is the material that makes…

Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…

A: there are two types purines and pyramidines. A=T G=C In case  of mRNA  A=U Thymine is replaced by…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…

A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arg-tyr. A…

A: Point mutations can be defined as mutations in single nucleotides. In point mutation, a nucleotide…

Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…

A: Translation:  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red…

A: NOTE:- As you posted multiple parts under one question, we will solve the first three for you, to…

Q: Sickle cell hemoglobin DNA CACGTAGACTGAGGACAC.. io.. A ... C... Sickle cell hemoglobin MRNA: Sickle…

A: Mutations are the change in the sequence of the DNA. Even a change in single base pair produces…

Q: A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the…

A: Amino acids are the organic compounds that contain the amino group (–NH2) and carboxyl group(–COOH)…

Q: codon

A: The number of codon binding sites in an mRNA-ribosome complex that can be occupied at the same time…

Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…

A: The synthesis of proteins with the help of  m RNA is know as translation.

Q: Which of the following is the complementary MRNA sequence to a DNA gene with the sequence 3'…

A: DNA is the basic unit of inheritance. DNA contains genes which are transcribed to messenger RNA and…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.