Q: The maximum number of amino acids that coded by 40 nucleotides in the MRNA are
A: mRNA plays a specific role in protein synthesis in the cell.
Q: If the following truncated peptide represents the active domain of the COVID19’s S-protein…
A: Mutations are alterations in the DNA sequence of an organism. Small changes, such as adding or…
Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)
A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…
Q: of hnRNA into mature mRNA incl
A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…
Q: TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
A: Transcription is the process which produces mRNA from DNA by the action of RNA polymerase.…
Q: Pre-mRNAs in mitochondria are converted to maturemRNAs through ______editing, which makes…
A: the RNA polymerase makes a complementary RNA transcript using the template strand of the DNA during…
Q: The gene for triose phosphate isomerase in maize (a corn plant) spans over 3400 base pairs of DNA…
A: The post-transcriptional modifications are observed during the processing of other transcripts which…
Q: Draw the SMN2 pre-mRNA (10 exons and 9 introns), indicate the 5’ and 3’ SS location. Draw the SMN2…
A: Proteins are obtained from DNA that contains the required genetic information. DNA is first…
Q: What is the amino acid sequence coded by this mRNA? MET SER ARG ASP VAL THR VAL LEU VAL SER O GLN…
A: A codon table can be used to convert a genetic code into an amino acid sequence. Because messenger…
Q: A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the…
A: Gene is the structural and functional unit in the DNA. Genes are composed of nucleotide nitrogenous…
Q: Describe briefly the generation of the active form of the transcription factor NFAT. Include the…
A: Nuclear factor of activated T cells (NFAT) was first identified as a Ca 2+/calcineurin-regulated…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: The process in which a specific sequence of DNA is copied to form a newly synthesized strand of…
Q: Describe in discrete steps how a polyadenylation signal contributes to the formation of a mature…
A: Answer: Introduction: Eukaryotic cellular process is regulated in the transcription process and RNA…
Q: Explain how RNA-binding proteins regulate the translationof specific mRNAs, using the regulation of…
A: The cellular iron content is maintained by the IRP-IRE regulatory mechanism. IRPs are cytosolic…
Q: An mRNA which has a structure of 5' GCGCGAUCUGCCGCUUCGCUACUA 3' Give the corresponding ntein seque…
A: A single-stranded RNA molecule usually gets to referred as the term messenger RNA (mRNA) is…
Q: Explain why prokaryotic ribosomes can translate a circular mRNA molecule, whereas eukaryotic…
A: The cytosol is the region in prokaryotes where ribosomes are present. In the prokaryotic ribosomes,…
Q: Define the following terms:a. cotranslational transferb. posttranslational transferc. TOM receptor…
A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: The method of Northern blotting is used to determine the amountand size of a particular RNA…
A: A gene is a stretch of nucleotides present on a chromosome. It is the region that encodes the…
Q: During periods of starvation, translation of only vital mRNAs must occur inside a cell. Explain how…
A: The pre-mRNA is composed of two regions, one is the intron, and the other is the exon. The…
Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced.Gcn4…
A: Translation is a process in which a single stranded RNA sequence formed at the end of transcription…
Q: Transcription occurs at a rate of about 30 nucleotides per second. is it possible to calculate the…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: Define the following terms:a. cohesinb. transcription factoryc. P bodiesd. CTCFe. ENCODE
A: There are cellular pathways that help to transfer genetic information and encode it to the protein.…
Q: true/ false Drosha and Pasha bind to mRNAs allowing the 43S subunit to form, but they inhibit the…
A: Drosha is a type III RNase, which plays a critical role in miRNA biogenesis. Pasha is an essential…
Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…
Q: c. On the mature mRNA transcript in eukaryotes, start codon is not found at the beginning of the 5'…
A: Mature mRNA transcripts in eukaryotes are those eukaryotic RNA transcripts that have been spliced…
Q: How is it possible that a given mRNA in a cell is found throughoutthe cytoplasm but the protein that…
A: The translation is a process of conversion of mRNA into specific amino acids in the cytoplasm of a…
Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…
A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…
Q: What is the order of the tRNA binding sites on the 70S ribosome with respect to the 5' 3' direction…
A: Each ribosomal subunit has three binding sites for tRNA: the A (aminoacyl) site, which accepts the…
Q: RNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of…
A: RNA silencing or RNA interference is a post transcriptional gene silencing process.IT is an…
Q: Explain how the pausing of the ribosome in the presence or absence of tryptophan affects the…
A: Tryptophan operon is an essential operon in bacteria such as Escherichia coli to synthesize the…
Q: The following is the only intron sequence of a gene that will be excised during the maturation of…
A: Prokaryotes have simpler cellular organization and gene structure when compared to eukaryotes.…
Q: GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
A: The sequence of mRNA is CCCUCACAUAUGCCCUACUUCCGCUAA. CCC- PROLINE UCA - SERINE CAU - HISTIDINE AUG-…
Q: Another thalassemic patient had a mutation leading to the production of an mRNA for the β chain of…
A: Thalassemias are hereditary blood diseases in which hemoglobin synthesis is reduced. Thalassemias…
Q: Atematve splicing of MRNAS in eukaryotic cells produces somewhat different proteins from a single…
A: Alternative splicing is the modification process of RNA(mRNA) by which an nascent mRNA is converted…
Q: If you were to remove the ER retrieval signal fromprotein disulfide isomerase (PDI), which is…
A: We got the information of first type in carboxyl terminus of soluble ER proteins and in golgi…
Q: While miRNA response elements (MREs) may be located anywhere within an mRNA, they are most often…
A: Micro-RNAs are defined as a class or group of non-coding RNAs that will play an essential role in…
Q: Match the given step with the major central dogma event being referred to. An enzyme covalently adds…
A: Addition of 7-methyl guanosine triphosphate to the 5' end of pre-mRNA is a post transcriptional…
Q: the difference in primary structure between related tropomyosin informs arises from a) alternative…
A: The primary structure of proteins means amino acid sequence which is synthesized during the protein…
Q: Bacterial messenger RNAs usually contain many AUG codons. How does the ribosome identify the AUG…
A: AUG codon codes for methionine. It is the initiation codon that helps in initiating the translation…
Q: The following logo plot represents the preferred cis-regulatory sequences (i.e. transcription factor…
A: JASPAR is an open-access database of curated. It is a non-redundant transcription factor (TF) which…
Q: The sequence of the sense strand of a mammalian gene is (shown). Determine the sequences of the…
A: mRNA is a eukaryotic RNA transcript that has been spliced and processed and is ready for translation…
Q: What protein sequence would a cell make from the following mRNA? 5'- CCAUGCACCAAUAGAUAACCG-3' O PCTN…
A: During the translation, the sequence of nucleotides in the mRNA is translated into a sequence of…
Q: GAC UAU GCG GGA GGO AAG CA UGA iwhat is The auino a cid that would Lesult from this m RNA SeepuenU?
A: Adenine in RNA binds with uracil (Thymine is replaced by uracil in RNA) and guanine with cytosine.…
Q: When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4…
A:
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: Describe the recognition process by whichthe tRNA for N-formylmethionine interacts with the portion…
A: Interpretation: The description of the recognition process by which N-formylmethionine bound tRNA…
Q: The coding sequence of insulin mRNA is 330 nucieotide long When it is translated to palypeptides,…
A: Peptides or proteins are composed of twenty standard amino acids. These twenty standard amino acids…
Q: MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene.…
A: DNA (deoxyribonucleic acid) is a double stranded molecule. One strand present in the 5’ to 3’…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13ebitgeqyloq erl to noihoq ertt qu 9lem bluow iert ebios onime et enimalsb nworle llew as yes TOi noitemoini ebulonl elelgmst AMO 3. The following MRNA strand is being used to assemble a polypeptide strand by a ribosome: 5'-AUGCUUGCUCAUCGGGGUUUUAA-3' AHR (a) Write out the amino acids that will be assembled, in their correct order. (b) Provide an alternative MRNA sequence with four or more changes that would translate to the same amino acid sequence.RNA codon table 2nd position A 1st U 3rd position position U Phe Phe Leu Leu Leu Leu C Leu Leu Ser Ser Ser Ser Cys Сys stop Тyr Тyr U stop Trp stop Pro Pro Pro Pro His His Gln Gln Arg Arg Arg Arg lle lle lle Met Thr Thr Thr Thr Asn Asn Lys Lýs Ser Ser Arg Arg Gly Glý Glý Glý A Val Ala Ala Ala Ala Asp Asp Glu Glu Val G Val Val Amino Acids Ala: Alanine Arg: Arginine Asn: Asparagine Asp:Aspartic acid Cys:Cysteine Gin: Glutamine Glu: Glutamic acid Lys: Lysine Gly: Glycine His: Histidine le: Isoleucine Ser: Serine Thr: Threonine Trp: Tryptophane Leu: Leucine Met: Methionine Phe: Phenylalanine Tyr: Tyrosisne Pro: Proline Val: Valine This figure shows the for translating each genetic codon in into an Four "special" codons are the codon: AUG ant the three codons: UAA, UAG, and UGA. The specification of a single amino acid by multiple similar codons is called believed to be a cellular mechanism to the negative impact of random TRUE or FALSE : Each species uses its own genetic code for protein…
- BM4_DNA AND PROTEIN S X /1FAIPQLSDP_g5B-629FSHNpGnTMIEppLS4A71zBd4vcUBqNUILubXONw/formResponse 4. What is the nitrogen base pair of Adenine in transcription? O Cytosine O Uracil O guanine O thymine 5. The central dogma of Molecular Biology states that There are four nitrogen bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine). Which process is not included in the central dogma? duplication transcription translation O translocation LeadpleKindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGmRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…
- Find 5’ UTR and 3’UTR of Mrna 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- w/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfmRNA sequence of A gene If we have the following mutations, find the type of the mutation (silent or missense or nonsense?) 17CàU 36GàA 49GàU 115AàC 5’ AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA CCCAGGGCGGGCCGUGACCCCUGCGGCGGAGAAGCCUUGGAUAUUUCCACUUCAGAAGCC UACUGGGGAAGGCUGAGGGGUCCCAGCUCCCCACGCUGGCUGCUGUGCAGAUGCUGGACG ACAGAGCCAGGAGGGAGGCCGCCAAGAAGGAGAAGGUAGAGCAGAUCCUGGCAGAGUUCCAGC UGCAGGAGGAGGACCUGAAGAAGGUGAUGAGACGGAUGCAGAAGGAGAUGGACCGCGGCCUGA GGUAGAAGCCGCUGGGGCUUGGGGCU-3’First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC GGU GGC AGA AGG Arginine GGA GGG Arginine Serine UOAGUO AGUOAGUCAG Glycine Which mutation would result in a conservative substitution with potentially serious consequences to the translation of the mRNA and synthesis of the protein? Third letter