A type of diabetes mellitus is due to defects in insulin signaling. True False
Q: What are the components of cephalins? Glycerol Two fatty acids Phosphoric acid Serine All of the…
A: Lipids are a very important class of biological molecule. Lipids can be classified into 2…
Q: Question 3: A runner just finished a marathon. For the enzymes listed below, indicate whether the…
A: During the marathon, the runner required extra glucose in the blood for physical activity.…
Q: What are the symptoms of nicotinamide deficiency and why are they so similar to the symptoms of an…
A: Nicotinamide is one of the forms of a vitamin, Niacin (Vitamin B3) in which the carboxyl group of…
Q: An animal cell is capable of converting alanine into serine. What is the shortest pathway using…
A: Amino acids are classically considered the building blocks for the synthesis of proteins. The unique…
Q: Using the information in the following graphs that show activity of phosphofructokinase (PFK) with…
A: Phosphofructokinase is belong to glucose kinase group of enzyme and phosphofructokinase can be…
Q: e. Write the equations involved in the neutralization process of antacids. (Gastrointestinal Agents)
A: Antacids are medicines that are used to treat acidity. Antacids cure acidity by reacting with acids…
Q: 2. Enzymes of the pyruvate dehydrogenase complex.
A: PDC is a multienzyme complex that catalyzes the conversion of pyruvate to acetyl-CoA via glycolysis.…
Q: 1) Gluconeogenesis refers to ________. A) the breakdown of glycogen B) the formation of glucose from…
A: Generally, glucose is the preferred source of energy in our body. But of we are not eating properly…
Q: A mixture of two proteins (both with molecular mass of 50 kDa) with an isoelectric points of 7.8 and…
A: Proteins are polymers of amino acids linked by peptide bond. Alpha carbon of amino acids contains…
Q: A(n) (hydrolysis, oxidation reduction, group transfer, isomerization, internal rearrangment)…
A: Fatty acids are carboxylic acids with a hydrocarbon chain ranging from 4 carbon to 36 carbons.…
Q: Complete the following reaction: P680 + light →_______→ O P680*; P680 + H+ O P680*; P680* + e O…
A: The P680 reaction center is a part of photosystem II. Upon getting hit by photons, P680 gets…
Q: Purine synthesis begins with the synthesis of IMP. Beginning with IMP, write the step(s) involved in…
A: Purines provide the essential components for DNA and RNA . They act as building blocks for the…
Q: Exam pe reaction That require energy Catabolic Allosteric site ADP+POATP Entropy increases 2nd law…
A: Enzymes are catalysts that speed up biochemical reaction. These are workable under particular…
Q: The pyruvate dehydrogenase (PDH) complex catalyzes the oxidative decarboxylation of pyruvate to…
A: Pyruvate dehydrogenase (PDH) complex oxidizes pyruvate to acetyl-CoA and carbon dioxide. It takes…
Q: There is also another follow up question can you help me with this too please In the second cross, a…
A: A rabbit's coat colour is determined by four alleles: agouti (C), chinchilla (Cch), Himalayan (ch),…
Q: Biological value of cerebrosides and gangliosides.
A: The glycosphingolipid family includes the cerebrosides, which are crucial parts of the membranes of…
Q: 1. Classification, structure and properties of higher fatty acids, their biological role.
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: Which of the following stabilize the hemoglobin quaternary structure of low-affinity to oxygen…
A: Haemoglobin is an important protein present in RBCs. It coprises of four subunits. Each subunit has…
Q: true or false: Pyrimidine synthesis involves the use of a molecule of N10-formyl…
A: Pyrimidine is one of the bases required in the nucleotides formation.
Q: Draw the steps involved in the catabolism of thymine into malonyl-CoA. Include the names and…
A: Nucleic acids are composed of nucleotides, and nucleotides are composed of a pentose sugar,…
Q: Which of the following is a second messenger that ultimately causes inhibition of glycogen synthase?
A: Glycogen synthase - is a key enzyme of glycogenesis and also called as UDP- glucosyltransferase. GS…
Q: He is administered a drug that inhibits bacterial enzyme that catalyzes bacterial DNA synthesis. The…
A: Enzyme inhibition is a process by which the activity of an enzyme is altered. Inhibitors are…
Q: 4. Why does DNA use Thymine instead of Uracil?
A: DNA is the type of nucleic acid, double stranded poly-nucleotide chain which work as the genetic…
Q: Name the components of products used in treating diarrhea and give the functions of each.
A: The term "gastrointestinal agents" refers to a broad category of medications used to treat…
Q: Epinephrine has the following structure. Which of the following amino acids are used by the…
A: Phe, Val, and Leu are hydrophobic amino acids that do not participate in H bonds or electrostatic…
Q: 2. The sequence of starting region of one DNA gene is shown: 5' GCATATGGCTTTTCCGCCGCGGCGACGGCTGCGC…
A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…
Q: . Mucic Acid Test for Galactose and Lactose
A: Galactose and lactose can be found using the highly specific mucic acid test, which is used to…
Q: Meselson-Stahl Experiment showed that DNA replication is semi-conservative. In the experiment, DNA…
A: During DNA replication, each polynucleotide strand serves as a template for the production of a…
Q: 1.How many chiral center does D-Eranose have？ 2. How many stereoisomer are possible for D-Eranose.
A: Conformation is the different positions a molecule can twist into. Configuration is the arrangement…
Q: In the presence of saturating amounts of oxaloacetate, the activity of citrate synthase from pig…
A: Citrate synthase is the first and regulatory step the enzyme of citric acid cycle (TCA). Citrate…
Q: Which of the following liver metabolic pathways are not normally active at the same time but are…
A: Cortisol : This is steroid hormone that increases blood glucose levels. it decreases glucose uptake…
Q: • What is the common name of this fatty acid? cerotic acid, lauric acid, lignoceric acid, linoleic…
A: Fatty acids (FA) are aliphatic chain with one terminal carboxylic acid. Based on the presence or…
Q: What is the molecular basis for the difference in the electrophorentic pattern between normal…
A: Hemoglobin is a globular protein, ie it is roughly spherical. It is a tetramer of two types of…
Q: Please calculate the number of ATP that can be generated from one molecule of the fatty acid shown…
A: Most of the body's fatty acids are oxidized by beta-oxidation. The oxidation of fatty acids on the…
Q: Once AMP and GMP are synthesized, they are then converted to ADP and GDP, then to ATP and GDP. What…
A: Adenosine & Guanosine are purine nitrogen bases. To these phosphate groups are attached. AMP…
Q: Describe how the results of carbon-14 labeling experiments demonstrated that the citrate cycle is a…
A: The citric acid cycle involves the oxidation of acetyl-CoA into carbon dioxide and water. It is the…
Q: In two of the first three steps of glycolysis: Group of answer choices Phosphorylation reactions…
A: Introduction All living organisms need energy to carry various activities. Once we take food, it…
Q: Which of the following can serve as a source of carbon for gluconeogenesis? O cholesterol O alanine…
A: Gluconeogenesis is the metabolic pathway that produces glucose from non carbohydrate precursors.…
Q: Which of the following statements concerning translation is NOT correct? O a. The first codon of…
A: Translation is the process of translating codons on mRNA into proteins. mRNA bind to ribosomes which…
Q: Which of the following is TRUE under the following conditions: the enzyme concentration is 2.5 nM,…
A: The rate of reaction can be determined by using Michaelis Menten equation. Michaelis Menten equation…
Q: What is the name of this cofactor related to niacin? 0
A: Enzymes are proteins that catalyse biochemical reaction. Sometimes enzymes require a non protein…
Q: hat roles do ionizable amino acids play in the active sites of enzymes
A: Enzymes are highly specialized proteins that have extraordinary catalytic power, greater than that…
Q: Do carbohydrates and sugars cause weight gain? Briefly Explain the answer.
A: Carbohydrates are biomolecules that act as the major source of energy. Sugars are carbohydrates with…
Q: Problem. The student conducted a chemical experiment to prove the reducing properties of maltose…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: LO43 Identify the levels at which gene expression can be regulated in prokaryotes and eukaryotes…
A: Gene regulation is the process of control of expression genes. This process occurs by several…
Q: A characteristic of complex III is that it is reduced by FADH2. participates in electron transfer…
A: ETC consist of four protein complexes called Complex I, II, III and IV that transport electron…
Q: In order to stabilize a protonated Asp amino acid in an active site, an enzyme could: Choose the one…
A: Enzymes are usually protein which consist of reactant/substrate binding site called as active site.…
Q: A patient of African American decent came in due to vasooclusive symptoms, you suspect a condition…
A: Hemoglobin is a tetrameric protein that transports oxygen to the tissues and CO2 to the lungs. Each…
Q: ----------------------the simplest lipids but they may be a part of or a source of many complex…
A: Lipids are a chemically diverse group of biomolecules that have two things in common: low…
Q: true or false: Glutamine PRPP amidotransferase is regulated via product inhibition.
A: Glutamine PRPP amidotransferase is an enzyme that catalyses the reaction of conversion of Phospho…
A type of diabetes mellitus is due to defects in insulin signaling.
True
False
Step by step
Solved in 2 steps
- Match the endocrine control concepts.Type-1 diabetes mellitus is: usually the result of abnormal target cell responsiveness usually the result of inappropriate hormone secretion a secondary pathology both a secondary pathology and usually the result of inappropriate hormone secretionWhich type of insulin can never be combined with any other insulin:
- Describe the physiological consequences of hormone imbalance in a person with diabetes mellitus.Compare and contrast the causes and symptoms oftype 1 and type 2 diabetes mellitus.Describe the symptoms of insulin-dependent and non-insulin-dependent diabetes mellitus and explain how these conditions are produced.
- Explain the actions of two hormones of the islets of Langerhans on the level of glucose in the blood. What is the consequence of insulin insufficiency or insensitivity as in the disease diabetes mellitus?What leads to type 1 diabetes mellitus? The individual is resistant to glucagon. The individual is not producing enough glucagon. The individual has a defect in the insulin receptors. The individual is not producing enough insulin.All of the following statements relating to endocrine signaling are correct EXCEPT:
- Diabetes insipidus has been identified in two males. One person did not have the condition until he had a stroke. The other had lived with the condition his whole life, and despite the existence of normal ADH receptors, it had never reacted to exogenous ADH. What might be the cause of the two men's diabetes insipidus? Provide your references.For both T1DM and T2DM, describe the following: Causes Symptoms Treatments Glucose levels Insulin levels Insulin receptor sensitivity Also please discuss the cause/effect relationship between acute and chronic stress (chronic disease or homelessness, for instance) and T1DM and T2DM. What is the mechanism by which the nervous system impacts stress hormones? Are there neurotransmitters involved? Which neurotransmitters? Which stress hormones?Tumors of the adrenal medulla, called pheochromocytomas, cause hypersecretion of catecholamines. Describe the expected signs and symptoms of this tumor.
