A specific single nucleotide variation in the human genome occurs with -2.5% frequency in the general population. This variation occurs within the protein coding region and results in an alanine where glycine is commonly found. This variant can best be described as a: Missense mutation Nonsynonymous coding single nucleotide polymorphism Non-coding single nucleotide polymorphism Synonymous coding single nucleotide polymorphism Sense mutation

A specific single nucleotide variation in the human genome occurs with -2.5% frequency in the general population. This variation occurs within the protein coding region and results in an alanine where glycine is commonly found. This variant can best be described as a: Missense mutation Nonsynonymous coding single nucleotide polymorphism Non-coding single nucleotide polymorphism Synonymous coding single nucleotide polymorphism Sense mutation

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 9QP: Define and compare the following types of nucleotide substitutions. Which is likely to cause the...

See similar textbooks

Similar questions

You learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…
A double mutant produced by uneven crossing-over contains two single nucleotide mutations that result in frame shifts and are separated by about 20 base pairs. The first is an insertion, while the second is a deletion. The amino acid sequences of the wildtype and mutant polypeptide in this region of the protein are as follows: Wildtype: Lys – Lys – Tyr – His – Gln – Trp – Thr – Cys – AsnDouble Mutant: Lys – Gln – Ile – Pro – Pro – Val – Asp – Met – Asn a) What are the original and double mutant mRNA sequences. You may find it useful to use the conventional symbols Y for pyrimidine, R for purine, N for any nucleotide, and H for A,C, or T. 2. b) Which nucleotide was inserted? 3. c) Which nucleotide was deleted?
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Pro
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Gl
If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)
A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by burning musclepain—all symptoms of late-onset muscular dystrophy. Hisinternist ordered genetic tests to determine whether he had oneof the most common adult-onset muscular dystrophies—myotonicdystrophy type 1 (DM1) or myotonic dystrophy type 2 (DM2). Thetests detect mutations in the DMPK and CNBP genes, the onlygenes known to be associated with DM1 and DM2. While awaitingthe results of the gene tests, the internist explained that thedisease-causing mutations in these genes do not result in changesto the coding sequence. Rather, myotonic dystrophies resultfrom increased, or expanded, numbers of tri- and tetranucleotiderepeats in the 3 untranslated region of the DMPK or CNBP genes.The doctor went on to explain that the presence of RNAs withexpanded numbers of repeats leads to aberrant alternative splicingof other mRNAs, causing widespread disruption of cellular pathways.This discussion…
A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by burning musclepain—all symptoms of late-onset muscular dystrophy. Hisinternist ordered genetic tests to determine whether he had oneof the most common adult-onset muscular dystrophies—myotonicdystrophy type 1 (DM1) or myotonic dystrophy type 2 (DM2). Thetests detect mutations in the DMPK and CNBP genes, the onlygenes known to be associated with DM1 and DM2. While awaitingthe results of the gene tests, the internist explained that thedisease-causing mutations in these genes do not result in changesto the coding sequence. Rather, myotonic dystrophies resultfrom increased, or expanded, numbers of tri- and tetranucleotiderepeats in the 3 untranslated region of the DMPK or CNBP genes.The doctor went on to explain that the presence of RNAs withexpanded numbers of repeats leads to aberrant alternative splicingof other mRNAs, causing widespread disruption of cellular pathways.This discussion…
A man in his early 30s suddenly developed weakness in hishands and neck, followed weeks later by burning musclepain—all symptoms of late-onset muscular dystrophy. Hisinternist ordered genetic tests to determine whether he had oneof the most common adult-onset muscular dystrophies—myotonicdystrophy type 1 (DM1) or myotonic dystrophy type 2 (DM2). Thetests detect mutations in the DMPK and CNBP genes, the onlygenes known to be associated with DM1 and DM2. While awaitingthe results of the gene tests, the internist explained that thedisease-causing mutations in these genes do not result in changesto the coding sequence. Rather, myotonic dystrophies resultfrom increased, or expanded, numbers of tri- and tetranucleotiderepeats in the 3 untranslated region of the DMPK or CNBP genes.The doctor went on to explain that the presence of RNAs withexpanded numbers of repeats leads to aberrant alternative splicingof other mRNAs, causing widespread disruption of cellular pathways.This discussion…