A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Gly

Q: Two missense mutations in the gene that encodes an enzyme called superoxide dismutase cause a form…

A: According to the question, we have to mention the codons which are responsible for the…

Q: What type of mutation occurred to produce the abnormal sequence (nonsense or missense)? Explain your…

A: A mutation is a change in a DNA sequence.

Q: Which of the following terms is used for the various forms of any one a) Autosomes b ) Codons c)…

A: Genes have a variety of different forms which are located at the same position or can be called…

Q: Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change…

A: Mutations are the abrupt changes in the DNA sequences due to wrong reading of the DNA polymerase…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: Define the silent mutation in DNA? (2.5 marks) 2) What is the codon usage bias? (2.5 marks) 3)…

A: Answer 1)  Silent mutations are DNA mutations that do not result in a change to the amino acid…

Q: Identify the mutation. Original DNA: TAC CCG AAT GGC ATT Mutated DNA TAC CCG AAC GGC ATT Use the…

A: To identify: The mutation in the given DNA sequence

Q: What does “Universality and Degeneracy” of the Genetic Code mean? State the significance of both the…

A: The genetic code is said to be nearly universal. It means that a given codon specifies the same…

Q: What do you have a nucleotide triplet codes for codon for UGU ? Identify a base pair substitution…

A: The DNA nucleotide triplet codes for RNA triplet codon which further codes for specific amino acid.…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: A nonsynonymous mutation is also referred to as missense mutation. Which of the following correctly…

A: Normal DNA contains a particular sequence of DNA. If the sequence of DNA is changed due to external…

Q: Based on the following wild type DNA sequence, indicate if each of the mutations should be…

A: The central dogma is DNA --> mRNA --> Protein. Hence, any mutations in the DNA lead to changes…

Q: Which of the following terms refer to the case when a mutation results in a partial loss of the…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while copying…

Q: A reversion is a mutation that returns a mutant codon back to acodon that gives a wild-type…

A: A mutation is a change in the DNA sequence, either due to mistakes during DNA replication or because…

Q: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

A: True or False Degeneracy of Genetic Code: 1. a given amino acid has more than one codon 2. the…

Q: Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the…

A: Introduction The process of duplicating a DNA molecule is known as DNA replication. When a cell…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…

A:

Q: Which of the following mutations near the beginning of a gene likely results in numerous amino acid…

A: Any detectable, inheritable, qualitative or quantitative change in the genetic material of an…

Q: The letters ABCDEFGH represent a normal DNA sequence. Indicate the type of mutation present in each…

A: Whenever there is a normal DNA sequence, but after DNA replication, or due to cellular stress or due…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…

A: We are answering four parts  For rest of parts pls repost.

Q: rmal hemoglobin is created from the codon GAA, which codes for glutamic d while sickle-cell…

A: Any abrupt change in the DNA sequence of nucleotides results in mutation its effects may be diverse…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: A DNA molecule is a double-helical structure.

Q: Baby Y has been diagnosed with the Graham-Snavely mutation. This mutation produces a disorder with…

A: Transcription is the process that refers to the formation of mRNA (messenger ribonucleic acid) which…

Q: Identify the type of mutation and how it would affect the protein made (amino acid) if the following…

A: Mutation It is defined as the alternation in the sequence of the DNA. This change occurs when the…

Q: 1) Define the silent mutation in DNA?  2) What is the codon usage bias?

A: Hi! As you have posted multiple questions and have not mentioned which one is to be answered, we are…

Q: When examining the genetic code, it is apparent that ________.     there are 44 stop codons…

A: The process of polypeptide chain synthesis or protein synthesis is known as translation. By this…

Q: he solution to question 13 of Chapter 11 in the Human Heredity textbook says an insertion of 3…

A: An inherited change in genetic information is called a mutation. It is a sudden change. The mutation…

Q: The genetic code uses combinations of 3 RNA bases as letters, each triplet specifies only one amino…

A: A genetic code is a triplet code of nucleotides that codes for a specific amino acid. It is also…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: A mutation is a heritable change in the Deoxyribose Nucleic Acid (DNA) grouping of a life form. The…

Q: These are portions of the coding strands of DNA for Wild-Type Hemoglobin and the mutated hemoglobin…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following are elongation factors involved in the attachment of new aminoacyl-tRNAs?…

A: During translation protein synthesis occurs from RNA. The sequence of nucleotides in RNA act as code…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutation is defined as sudden inheritable change that occurs in the DNA sequence. It may be…

Q: A SNP that results in loss of all catalytic activity of a drug-metabolizing enzyme is most likely to…

A: snip is genetic variation which may leads to replace cytosine with thymine at the same places along…

Q: Which of the following mutations would be most likely to have the most negative effect on the…

A: Translation is the process of synthesis of protein in the cytoplasm.

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction:  Mutations are changes in the genetic material or character of an organism. It can…

Q: The following is the base sequence of DNA that codes for amino acids 506-510 of the protein that…

A: Since we only answer up to 3 sub-parts, we’ll answer the first 3. Please resubmit the question and…

Q: Which DNA strand is identical to the mRNA transcript? Which DNA strand codes the RNA transcript?

A: DNA contains the instructions for protein synthesis. Proteins in turn determine structure and…

Q: The infectious prion protein which are believed to cause a neurodegenerative disease by acting as a…

A: neurodegenerative diseases which are due to the infected prions can occur both in animals and in…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: A mutation is a permanent change in the DNA of a cell such that the sequence deviates from what is…

Q: A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid…

A: Mutations are changes that occurs in the deoxyribonucleic acid (DNA) sequence, either due to…

Q: The following fragment of DNA is from the template strand. First determine the amino acids of the…

A: DNA -> Transcription -> mRNA -> Translation -> Protein Transcription is the synthesis of…

Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: In the image below, the blue squiggly line represents a folded protein. There are two particular…

A: Protein is a nitrogenous organic macromolecule that is crucial to human health. It is responsible…

Q: CUGCUGUGCAGAUGCUGGACG

A: A missense mutation occurs when there is a mistake in the DNA code and one of the DNA base pairs is…

Q: Which of the following mutations in the protein-coding region of a gene is more likely to lead to…

A: A frameshift mutation is a type of gene mutation in which the insertion or deletion of one or more…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine.  GGA codes for Glycine.  Since the protein being coded for is completely…

Q: Line A below shows the peptide synthesized after transcription and translation of a piece of DNA.…

A: Any detectable, inheritable qualitative or quantitative changes in the genetic material of an…

Q: As described earlier, DNA damage can cause deletion or insertion of base pairs. If a nucleotide base…

A: A mutation will take place when a DNA gene is either damaged or changed so that it alters the…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.