Baby Y has been diagnosed with the Graham-Snavely mutation. This mutation produces a disorder with the following symptoms: migraine headaches, insomnia, uncontrollable crying, and hand cramps. This mutation is found in the EXM gene. The mutated form of the gene produces a protein that has three serine amino acids grouped together and at the very end is an alanine amino acid. Unfortunately, our machine that transcribes and translates is not working, so you need to perform that by hand. Luckily, we did manage to sequence the EXM gene for the potential fathers. This analysis will be used as evidence as to which man is the father of Baby Y. These are the same 4 sequences that are found in the Supplemental Document. Daddy A: 3-TAC-TGG-GTA-AGA-TCA-AGG-TTT-CGG-ATT-AAC-5 Daddy B: 3'-TAC-TGG-AAA-AAG-AAC-AGG-TTT-CGG-ATT-AAC-5' Daddy C: 3'-TAC-TGG-GTA-AGT-TCA-AGG-TTT-CCG-ATT-AAC-5' Daddy D: 3'-TAC-TGG-GTA-AGT-TCA-AGG-TTT-CGG-ACT-CGC-5' Based on your transcription for each father's EXM gene, provide the Translation for each of the potential fathers in the space provided below.

Baby Y has been diagnosed with the Graham-Snavely mutation. This mutation produces a disorder with the following symptoms: migraine headaches, insomnia, uncontrollable crying, and hand cramps. This mutation is found in the EXM gene. The mutated form of the gene produces a protein that has three serine amino acids grouped together and at the very end is an alanine amino acid. Unfortunately, our machine that transcribes and translates is not working, so you need to perform that by hand. Luckily, we did manage to sequence the EXM gene for the potential fathers. This analysis will be used as evidence as to which man is the father of Baby Y. These are the same 4 sequences that are found in the Supplemental Document. Daddy A: 3-TAC-TGG-GTA-AGA-TCA-AGG-TTT-CGG-ATT-AAC-5 Daddy B: 3'-TAC-TGG-AAA-AAG-AAC-AGG-TTT-CGG-ATT-AAC-5' Daddy C: 3'-TAC-TGG-GTA-AGT-TCA-AGG-TTT-CCG-ATT-AAC-5' Daddy D: 3'-TAC-TGG-GTA-AGT-TCA-AGG-TTT-CGG-ACT-CGC-5' Based on your transcription for each father's EXM gene, provide the Translation for each of the potential fathers in the space provided below.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
Discuss how degeneracy of the genetic code makes cells more robust to mutations.
Discuss Concepts A mutation occurs that alters an anticodon in a tRNA from 3-AAU-5 to 3-AUU-5. What effect will this mutation have on protein synthesis?
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
What processing step enhances the stability of pre-tRNAs and pre-rRNAs? methylation nucleotide modification cleavage splicing
Which statements are true? Explain why or why not.1 The consequences of errors in transcription areless severe than those of errors in DNA replication.2 Since introns are largely genetic “junk,” they do nothave to be removed precisely from the primary transcriptduring RNA splicing.3 Wobble pairing occurs between the first positionin the codon and the third position in the anticodon.4 During protein synthesis, the thermodynamics ofbase-pairing between tRNAs and mRNAs sets the upperlimit for the accuracy with which protein molecules aremade.5 Protein enzymes are thought to greatly outnum-ber ribozymes in modern cells because they can catalyzea much greater variety of reactions and all of them havefaster rates than any ribozyme.
Topic: Splicing a. What is the big picture of splicing and what is the importance of this concept in biology?b. What are the processes that are controlled or regulated or affected by this concept and why must these processes be controlled or regulated in the first place?
. Why is a nonsense suppressor tRNATyr, even though ithas a mutant anticodon that cannot recognize a tyrosinecodon, charged with tyrosine by Tyr tRNA synthetase?
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
Based on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…
SARS E You have generated several random mutations in this region. One of them is - 5'-AAUUACCUAUAGAUUGUUU-3' What may be the mutant protein sequence Enter the single letter code for the amino acids. For a stop codon (if any) enter: STOP And fill subsequent blanks with: N/A For example: if you the sequence you need to enter is: M*, enter M N/A N/A N/A N/A