Fill in the blanks 2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:)Choose one:Choose one:InterphaseMitosisCytokinesisChoose one:DNA replication usesof DNA3. (Select one aas templatesof a DNA molecule.because each new DNADNA replicatimolecule has 1 original strand of DNA and 1 new strand of DNA. This ensures the conservationof genetic information.4.5. (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that aregenetically Cheose one:Choose one:This process is used to make6. Match the following Mitosis stages to what happensProphaseMetaphaseAnaphaseTelophasea. sister chromatids pull apart to opposite ends of cellb. chromosomes line up at the equator of the cellc. Nuclear envelope reforms and chromosome loosend. nuclear envelope disappears, chromosomescondense7. During what phase does the cytoplasm divide? (Select one answer from dropdown menu:)Choose one: What are the three reasons that cells typically divide?a. Growthb.Repairc. Replacement2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:)Choose one:3. (Select one answer from each dropdown menu:) DNA replication uses,Choose one:of DNAas templates to make an Choose one:one strandboth strandsbecause eachChoose one:copy of a DNA molecule.4. DNA replication is known as beingmolecule has 1 original strand of DNA and 1 new strand of DNA. This ensures the conservationof genetic information.5. (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that aregenetically Choose one:This process is used to makeChoose ond:6. Match the following Mitosis stages to what happensProphaseMetaphaseAnaphaseTelophasea. sister chromatids pull apart to opposite ends of cellb. chromosomes line up at the equator of the cellC. Nuclear envelope reforms and chromosome loosend. nuclear envelope disappears, chromosomescondense7. During what phase does the cytoplasm divide? (Select one answer from dropdown menu:)Choose one:

DNA replication is semiconservative in nature, where each daughter DNA molecule has one parent…

2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose one: Choose one: Interphase Mitosis Cytokinesis ) DNA replication uses of DNA 3. (Select one a as templates of a DNA molecule. because each new DNA 4. DNA replicatihoose one:

2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:) Choose one: Choose one: Interphase Mitosis Cytokinesis ) DNA replication uses of DNA 3. (Select one a as templates of a DNA molecule. because each new DNA 4. DNA replicatihoose one:

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 23QP: How does DNA replication occur in a precise manner to ensure that identical genetic information is...

See similar textbooks

Related questions

Q: Continuing from the question above. You are able to correctly modify the blood stem cells and return…

A: Sickle cell anemia is majorly due to missense mutation which results in valine substitution in place…

Q: Protein P, normally stimulates apoptosis or cell death when activated. Consider a cell with a…

A: The construction of this question gives us an information about the nature of protein P, P when…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: The ff. mothers, (A) through (E) with given phenotypes, each produced one child whose phenotype is…

A: This question can be done by splitting each trait and crossing the concerned trait of mother and…

Q: If a person has one gene influencing blue eyes but actually has brown eyes, blue eyes must be a…

A: Introduction :- When two or more genes control the same trait, it is known as polygenic inheritance.…

Q: Which of the following are true for the c-myc gene? Select all that apply

A: Myc is a group of regulator genes that code for transcription factors. c-myc is one of the genes in…

Q: 7. The antibodies sure seem to be taking a long time. You are dying to know where in the cell YFP is…

A: Antibody, also known as immunoglobulin, is a protective protein produced by the immune system in…

Q: Describe the properties of the genetic code - how many codins code for amino acids, stop colons,…

A: The genetic code can be defined as a set of specific rules for a living cell to translate…

Q: Certain cells in the retina respond differently to the direction in which objects move. To…

A: A retinal ganglion cell (RGC) :- is a kind of neuron which is found near the inner surface of the…

Q: Explain how each of the following tests for syphilis is best used by describing what each tests for…

A: RPR (VDRL) is test for screening syphilis. RPR stands for Rapid Plasma Reagin and the abbreviation…

Q: Assignment in Modules 4-6 Matching Type: Match Column A with Column B. Type the answer before the…

A: 1) phenylketonuria is the genetic defect in which the child is unble to breakdown the protein called…

Q: 9. According to the figure, the predominant plant in an open site is roughly size. Adult 3 Category…

A: Introduction The term "population" usually refers to the number of people living in a specific area,…

Q: What is the pH of blood? The pH Scale Ammonia Stomach Acid Vinegar Coffee Water Baking Soda Solution…

A: pH is the measure of how acidic or basic a liquid is. Range of pH scale is 0-14. <7 being the…

Q: Question z Methanogens are always engaged in relationships with other microbes because methane…

A: Answer- interspecies hydrogen Transfer. Interspecies hydrogen transfer (IHT) is a form of…

Q: Question 6-10: Choose the enzyme and match it to its function. Bubble the correct letter on the…

A: Primase is an RNA polymerase that requires ssDNA to make RNA primers during DNA replication.

Q: 1. Base on the graph below, why might the sex ratio of bird species in the figure change from as…

A: Juvenile involving young people who are not yet adults . In the birds the frequency change from…

Q: Which of the following images shows a phage with a Siphoviridae morphotype? A) B) C)

A: Siphoviridae viruses are double stranded DNA viruses which belong to order Caudovirales. this family…

Q: Answer each question in 300 words: 1. What size and shape of quadrat would you use to measure (a)…

A: Introduction-This protocol provides standardized data on seagrass percent cover, species…

Q: Analysis of urine is routinely used in medical screening. The presence of glucose in the urine is…

A: In a healthy person the kidney excretes waste materials of body . Kidneys don't excrete essential…

Q: What made the angiosperms the most successful terrestrial plants? Discuss your answer.

A: Answer Angiosperms are the most dominant form of plant life in most terrestrial ecosystem.

Q: David isolated 3 unidentified strains of bacteria from a patient's wound. He wants to determine if…

A: Lysogeny is the state where a host cell contains one or more prophages and lysogenic cells contains…

Q: A cladogram or phylogenetic tree is used to classify organisms into groups based on their shared…

A: A cladogram or a phylogenetic tree is a type of evolutionary tree showing representation or…

Q: You want to test if oxygen consumption rates are different in males and females of a newly…

A: solution---- The maximal oxygen consumption rate (VO2 max) is a measure of how much oxygen is used…

Q: 2-Deoxyglucose or 2-DG is a glucose analog that binds to hexokinase (the first rate- limiting enzyme…

A: ATP is the currency of the cell and it starts with glycolysis. Glycolysis is the breakdown of…

Q: BLASTP helps to predict the function of phage proteins by finding the e-value of phage proteins O…

A: BLAST stands for Basic Local Alignment Search Tool (BLAST) This is helpful in finding location of…

Q: For one ribosome-specific antibiotic, identify the specific step in translation that it blocks?

A: Drugs that are used to treat microbial infections are commonly referred to as antimicrobial agents.…

Q: STUDY QUESTIONS 1. List down at least 3 differences in the anatomy of male and female frogs. 2. How…

A: Frogs are amphibians and humans are mammals.

Q: Explain the various anthropogenic causes of the water cycle.

A: The water cycle, also hydrological cycle or the water balance, is the continuous water flow on,…

Q: 2. Dosage analysis Genotype Phenotype N'/N Notched wing Df (N) / N' lethal Dp (N*)/ N Confluens wing…

A: N1is the spontaneous mutation in X-chromosome

Q: Two homologous chromosomes in ES cells are depicted below with the portion of your gene of interest…

A: CRISPR/Cas9 creates specific double-stranded breaks at the target locus that trigger DNA repair…

Q: Ascaris lumbricoides, I.s. Illustrate the stages of mitosis, as seen under HPO. Label the stages…

A: Answer :: Cell division:- Cell division happens when a parent cell divides into two or more…

Q: My field is COSMETIC SCIENCE What information can be obtained from UV-vis Spectra and how this can…

A: Ultraviolet Visible spectroscopy (UV-Vis spectroscopy) is an analytical technique, which measures…

Q: What are a deletion loop and an inversion loop? What is the importance of these loops during cell…

A: Introduction Mitosis and meiosis are the two kinds of cell division. When people say "cell…

Q: Pyruvate kinase, a glycolysis enzyme

Q: Change in gene frequencies within a reproductive population is called: O allopatric speciation. O…

A: Evolution is defined as a change in the inheritable traits of biological populations, over multiple…

Q: Nutrients in the soil, such as phosphorus and potassium, play an important role in plant…

A: “Nutrients are the compounds required and that provide energy, allowing to heal and in the…

Q: Gene A encodes for a protein A which prevents exit from the G1 phase of the cell cycle. You are…

A: Cancer is the uncontrolled cell division that is highly under the control of genes. Cell cycle is a…

Q: discribe the various measures of strength of biological materials

A: For the measurements of biological materials strength various type of unit are used... 1. Like ATP…

Q: economic and ecological significance of Rye (Secale)

Q: 5

A: Answer cat ovary with labelling

Q: of the following is not an example of green infrastructu Pavement Bioswales Bioretention Planter…

A: Lack of greenery has made the life difficult. In order to promote greenery and conserve water, green…

Q: 1. Differentiate between prokaryotic and eukaryotic cells? 2. In your view, which cellular organelle…

A: Introduction Cell:- It is a mass of cytoplasm that is bound externally by a cell membrane, It is the…

Q: How do plants and animals regulate their body fluids? Why do you think body regulation is important…

A: The regulation of concentration of body fluids is called as osmoregulation. • The plants absorb…

Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…

A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…

Q: AN

A: Male toad

Q: Which of the following is NOT a true statement? Action potentials are generated only when a neuron…

A: There are few important points that should be kept in mind: Neurons possess electrical excitability…

Q: populations of flightless grasshoppers (Population A and B) are separated by a river that contains…

A: This is a type of natural selection occurring here. Natural selection was a concept given first by…

Q: Metabolic syndrome is a clustering of various conditions including high blood pressure, high blood…

A: Metabolic syndrome is a group of disorders that occur in tandem and increase your risk of heart…

Q: Benzoic acid has an absorption maximum at 230 nm. Where do you expect (give a value) to see the…

A: The neutral benzoic acid is acidic in nature and at pH lower than 7 benzoic acid obtain high…

Q: How does we know that trees or plants are transpiring base on your experiment?

A: The physiological process by which water is lost in the form of vapour from the living tissues of…

Concept explainers

Ecological adaptations

An ecological adaptation is any morphological, physiological, or behavioral trait of an organism that allows it to survive and reproduce in a habitat or ecosystem. Adaptation is a biological mechanism by which an organism gradually gets more acclimated to its surroundings.

Question

Fill in the blanks

2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:)
Choose one:
Choose one:
Interphase
Mitosis
Cytokinesis
Choose one:
DNA replication uses
of DNA
3. (Select one a
as templates
of a DNA molecule.
because each new DNA
DNA replicati
molecule has 1 original strand of DNA and 1 new strand of DNA. This ensures the conservation
of genetic information.
4.
5. (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that are
genetically Cheose one:
Choose one:
This process is used to make
6. Match the following Mitosis stages to what happens
Prophase
Metaphase
Anaphase
Telophase
a. sister chromatids pull apart to opposite ends of cell
b. chromosomes line up at the equator of the cell
c. Nuclear envelope reforms and chromosome loosen
d. nuclear envelope disappears, chromosomes
condense
7. During what phase does the cytoplasm divide? (Select one answer from dropdown menu:)
Choose one:

What are the three reasons that cells typically divide?
a. Growth
b.Repair
c. Replacement
2. During what phase does DNA replication occur in? (Select one answer from dropdown menu:)
Choose one:
3. (Select one answer from each dropdown menu:) DNA replication uses,
Choose one:
of DNA
as templates to make an Choose one:
one strand
both strands
because eachChoose one:
copy of a DNA molecule.
4. DNA replication is known as being
molecule has 1 original strand of DNA and 1 new strand of DNA. This ensures the conservation
of genetic information.
5. (Select one answer from each dropdown menu: ) In mitosis, the goal is to get cells that are
genetically Choose one:
This process is used to make
Choose ond:
6. Match the following Mitosis stages to what happens
Prophase
Metaphase
Anaphase
Telophase
a. sister chromatids pull apart to opposite ends of cell
b. chromosomes line up at the equator of the cell
C. Nuclear envelope reforms and chromosome loosen
d. nuclear envelope disappears, chromosomes
condense
7. During what phase does the cytoplasm divide? (Select one answer from dropdown menu:)
Choose one:

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Choose all of the true statements about DNA replication in cells. Hint: 2 statements are true. O Prokaryotic chromosomes contain hundreds of origins of replication. Primers are composed of RNA nucleotides that are complementary to the DNA template strand. DNA polymerase proofreads and replaces ALL errors during DNA copying Primers are short DNA sequences which DNA polymerase can bind to. O Eukaryotic chromosomes contain many origins of replication.
Which of the following statements is NOT TRUE about genomic DNA replication? O A DNA replication begins at the origin of replication and proceeds bi-directionally O B. New nucleotides can be added by the DNA polymerase only to the 3 end of the growing strand O. Synthesis of new DNA is catalyzed by the enzymes called DNA polymerases OD. DNA replication is semi-conservative OE. DNA replication proceeds continuously on both parental DNA strands.
A. Which of the followings are characteristics related to eukaryotic replication? * 1. DNA linear in nature 2. Replication takes place in cytoplasm 3. DNA circular in nature 4. DNA replicates in nucleus 5. One replication origin 6. Unwinds in multiple areas
14. What term describes this change + LYNAS age to DRZAT 15. Now, transcribe and translate the DNA strand below. Remember to use the start and stop sequences. ACGGTACCGTTAGCCGACATCGGGGACACTGACTCG
4, Describe the process of DNA replication. In your description, include the terms okazaki fragments, lagging, and leading. polymerase, ligase,
Watch this video (http://openstaxcollege.org/l/DNArep) to learn about DNA replication. DNA replication proceeds simultaneously at several sites on the same molecule. What separates the base pair at the start of DNA replication?
Which of the following components is not involved during the formation of the replication fork? single-strand binding proteins helicase origin of replication ligase
How does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.
Review Figures 8.12 and 8.13. In cells, the primers for DNA synthesis are short strands of RNA, so each newly-synthesized strand of DNA has a segment of RNA al its 5 end. As replication proceeds, DNA polymerases remove these RNA segments and fill in the resulting gaps with DNA. However, the gaps at the very 5 ends of the new strands cannot be filled in with DNA. Why not? DNA replication leaves exposed about 100 nucleotides al the 5 end of each template strand, and these single-stranded ends are removed. What are the effects of this "end problem" on a cell's DNA as it continues to divide? FIGURE 8.12 DNA replication. Green arrows show the direction of synthesis for each strand. The Y-shaped structure where the DNA molecule is being unwound is called a replication fork. FIGURE 8.13 Discontinuous synthesis of DNA. This close-up of a replication fork shows that only one of the two new DNA strands is assembled continuously. The other is assembled in short segments.
Which of the following is part of the elongation step of DNA synthesis? pulling apart the two DNA strands attaching complementary nucleotides to the template strand untwisting the DNA helix none of the above
Which of the following statements is/are TRUE for DNA Replication? Two daughter DNAs are formed, each one contains an old and new strands. When the (parent) DNA strands unwind, the 3'→ 5' strand is the leading strand while the 5'→3' strand is the lagging strand. Requires dATP, dTTP, dGTP, dCTP and Mg2+ The replisome is the biological machine responsible in replicating DNA.
5. The following diagram uses colors to illustrate the replication of a chromosome. Use your knowledge of DNA replication to determine whether or not the illustration is accurate. If it is not accurate, briefly ex- plain how to make it correct. DNA molecule prlor to replikation DNA moleaule is replkated DNA molecule DNA molecule after replcation after replkation