14. In an a-helix, a hydrogen bond is formed between the carbonyl oxygen of the residue and the amide hydrogen residues away A. i+1 B. i+4 C. i+3 D. i+2 E. i+5
Q: What is expected to happen to a suspended protein when the pH of the solution is adjusted to the…
A: The pH impacts the precise nature of protein interactions by altering the protonation state of…
Q: What is the osmotic pressure of a 38 M glucose solution that intravenously injected to the blood at…
A: Glucose is a monosaccharide and it is a simple sugar that is the most important source of…
Q: Q1. Many of the components for lipid synthesis need to be "activated", which happens by a variety of…
A: Lipids are non-polar biomolecules, which act as the major components of the plasma membrane, energy…
Q: 6. Gluconeogenesis generates ________. Select one: A. 2 ATP and 2 NADH B. 1 ATP and 1 NADH C. 1…
A: Gluconeogenesis is a metabolic pathway that results in the generation of glucose from certain…
Q: 1. What happens to the rate of liver glucose metabolism during moderate intensity exercise? 2. Would…
A: Carbohydrates are the main energy source for body, they broke down in to glucose as the sole ATP…
Q: State other biologically and commercially polysaccharides then give its commercial uses
A: Polysaccharides are the most common type of carbohydrate present in foods. They are biopolymer…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: (a) What is the difference between low-density lipoproteins (LDLs) and high-density lipoproteins…
A: Cholesterol is a chemical that the body produces naturally. Cholesterol is a component of cell…
Q: What is the correct sequence of steps in the light reaction? ADP + Pi --> ATP oxidation of water…
A: In plants, photosynthesis occurs in two stages one is light-dependent and the other is…
Q: What are two important compounds that lie at crossroads of major metabolic pathways? Select both…
A: Metabolic pathway engineering in microbial hosts for heterologous biosynthesis of commodity…
Q: 10 b. How many different proteins composed of 100 amino acids could possibly exist?
A: The building blocks for the synthesis of proteins are amino acids. 20 different amino acids…
Q: Please explain how glycolysis is linked to the CAC.
A: CAC : Citric acid cycle Pyruvate : Glycolysis end product Glycolysis, the CAC are linked via the…
Q: ADP molecules phosphate molecule intermembrane space ATP synthase H+ ions CoQ mitochondrial matrix…
A: A widely accepted model for ATP synthesis is the binding change mechanism or flip-flop…
Q: Mechanism for Acid-Base Balance What happens with this mechanism to regulate the body to become more…
A: The bicarbonate/carbonic acid buffer system is found in blood and many other tissues. It balances…
Q: What is the difference between substrate-level phosphorylation and oxidative phosphorylation? Please…
A: Phosphorylation : The transfer of the phosphate group from one compound to the other. Substrate…
Q: 135.) In the citric acid cycle, oxidoreductases are reversible. A) 0 of 4 B) 1 of 4 C) 2 of 4 D) 2…
A: The citric acid cycle oxidizes the acetyl Co-A into the carbon dioxide in the mitochondria. The…
Q: What is the purpose of adding the dishwashing liquid to the DNA extraction?
A: DNA extraction is a method of separating DNA from cell membranes, proteins, and other cellular…
Q: Show a chemical reaction involving hydrogen peroxide and the enzyme present in potato. What enzyme…
A: Chemical reactions and processes are sped up by catalysts or chemicals found in all living things.…
Q: Do reducing sugars have a reactive anomeric carbon? explain
A: Carbohydrates are divided into 3 classes monosaccharides, disaccharides, and polysaccharides.…
Q: Which THREE statements are true about targetting proteins to the nudieua? Aln the cytoplasm, a…
A: Nuclear localization signals mediates the transport of proteins from the cytoplasm into the nucleus.
Q: The reason for the increase in the rate of an enzyme reaction when the temperature is increased is…
A: The increase in the rate of Enzyme reaction is due to the increase in kinetic energy and the…
Q: Identify the ligand that bind to uniprotkb-P39086, the type of allostery, and describe the general…
A: P39086 is an ID for a protein GRIK1_HUMAN that belongs to Homosapiens. It is a protein of 918 amino…
Q: Which of the following was added to cell lysate to stabilize RNA molecules during the RNA…
A: RNA Extraction is the process of purification of RNA from biological samples. A Trizol Reagent is…
Q: Calculate the concentration of a-ketoglutarate if the concentration of isocitrate is 18.9 mM and the…
A: Lets assume that all the given concentrations are equilibrium concentrations and we are expected to…
Q: A) Determine Vmax and Km of the reaction in the absence of inhibitor. B) Determine the inhibition…
A: Enzyme kinetics - it is a study of enzyme catalyzed chemical reactions in which reaction rate is…
Q: Which of the following steps does NOT require ATP? O A. Conversion of glucose to glucose 6-phosphate…
A: Metabolic pathways are a series of process which includes chemical reactions occurring in a cell.…
Q: Based on the observations below, make a brief statement on the identity of the sample. Test…
A: Introduction: Carbohydrates are an important source of energy used by all living things. It serves…
Q: Is taking Multivitamins plus zinc every day affect Our lipid metabolism? If yes, in what way?
A: Zinc, alone or in conjunction with some other recognised antioxidant minerals and vitamins, may…
Q: What is Therapeutic Drug Monitoring (TDM) and under what circumstances would it be considered for a…
A: Therapeutic drug monitoring (TDM) is commonly described because the medical laboratory size of a…
Q: Complete the sentences to explain how the H Match the words in the left column to the appropriate…
A: The electron transport chain is a series of proteins and organic molecules found in the…
Q: At the gym, you expend 230 kcal riding the stationary bicycle for 1 h. ▼ Part A How many moles of…
A: ATP is the form of energy for storage and use at cellular level. It stores energy that is released…
Q: 2. Use your knowledge of amino acids (and the R groups) and tertiary structures of proteins to…
A: Sickle cell disease is a disorder of red blood cells that are inherited. This is a disease that is…
Q: the Km of an enzyme for its substrate tends to be close to the physiological (cellular)…
A: Enzymes are the biological catalyst which to increase the rate of reaction. Km is also called as the…
Q: Explain what hydrogels are as a group of material. Discuss and illustrate with examples the most…
A: Large molecules which are synthetically made or obtained naturally and are made up of many simpler…
Q: Currently available INSULIN PRODUCTS/MEDICATIONS in the market: Brand Name Route Onset (min.)…
A:
Q: Hormone Testosterone Function Name and Structure of attached molecule
A: Living things coordinate their activities at every level of their organization through complex…
Q: On a mass basis, fats are more efficient sources of energy than carbohydrates but carbs may be…
A: Carbohydrates are the basic components of our food. It is organic compounds produced in the…
Q: Angiotensin-converting enzyme inhibitors (ACE inhibitors) are used to treat high blood pressure.…
A: ACE is an enzyme in the Renin-Angiotensin-Aldosterone pathway (RAAS). ACE inhibitors (ACE I)…
Q: What is hydatid cyst disease? What complication/s can occur? What is cysticerosis? How is it…
A: A disease is described as a particular abnormal condition that has a very negative effect on…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: acetate buffer works on fumarase activity but tris-maleate buffer does not
A: Fumarase is an enzyme that catalyzes reversible conversion of fumarase to malate in TCA cycle.…
Q: The melting temperatures of osazones are easily determined and are characteristic for each. Listed…
A: Carbohydrates are abundant biomolecule in the nature. They are polyhydroxy aldehydes or ketones.…
Q: what is the role of amino acids in purine metabolism?
A: Purine metabolism is described as a process in which different metabolic pathways are followed so as…
Q: Which would be faster to metabolize starch glucose galactose
A: Metabolism is a set of chemical reactions through which what we consume through food through diet…
Q: Pathologic and Non-pathologic causes of Urine Turbidity.
A: A turbid urine is defined as an unclear and cloudy urine when viewed directly. There can be various…
Q: Contrary to legend, camels do not store water in their humps, which consist of large fat deposits.…
A: Tripalmitoylglycerol is formed by three palmitoyl-CoA molecules. As a result, it is required to…
Q: Given the knowledge of biochemistry, make a sample outline of a new 24-hour healthy meal. Provide…
A: The human body can be viewed as an engine that releases the energy contained in the foods it…
Q: PSI ROS phosphorylated and repr es the 24 hol period in the absence of any light cues. In VIVO in…
A: An alternative pathway for glucose oxidation is the pentose phosphate pathway (PPP). In…
Q: Use the Michaelis-Menten equation to complete the enzyme kinetic data set, when Km is known to have…
A: Introduction: The theory of enzyme kinetics was proposed by two scientists Leonor Michaelis and…
Q: 30. assicuatuib if 2alpha and 2 beta chains to form adult hemoglobin
A: HbA2 is a gene that in encodes for the alpha globin chain of haemoglobin in humans.
Step by step
Solved in 2 steps with 1 images
- 3. Below is the structure of a nucleotide triphosphate. ATP R-O- R-O R-O- OIP O P -O O OP ADP OIPIO b. a. Label each phosphate group as a, ß, or y in boxes provided below each phosphate group. Put an "X" under all products you would expect from nucleophilic attack at the y phosphate group by a generic alcohol (R-OH). fofo O H R-O O. H Adenosine R-O OH fof O O=P O O H R-O-Adenosine H OH OIPIO NH₂ O-AMP AMP N O=0 O-Adenosine11. A polypeptide is making a short a-helix. A typical residue in an a-helix is involved in two H-bonds. At a minimum, how many residues this helix could have?8. Amino acids typically consist of a central carbon atom. Attached to this central carbon are an amino group, a carboxylic acid group, a side chain (the R group), and a hydrogen (a-hydrogens). What would happen to the a-alpha helix if a-hydrogens are replaced by a second side chain (second R group)?
- 14. Draw the structure of a U•A•U base triple. Draw hydrogen bonds as dashed lines, and draw hydrogen atoms involved in hydrogen bonds. How many base pairs exist in this base triple? Indicate the position of the ribose with an "R" (you do not need to draw the ribose. Use separate page/back if necessary).13. Draw the structure of a G•U base pair with two hydrogen bonds. Draw hydrogen bonds as dashed lines, and draw hydrogen atoms involved in hydrogen bonds. Indicate the position of the ribose with an "R" (you do not need to draw the ribose (just the nucleobases and H-bonding interactions).1. The structure is a monomeric unit of what polynucleotide: DNA or RNA?2. What is the bond that links the nucleobase with the sugar? a. sugar bondb. phosphate ester bondc. N-C glycosidic bondd. phospodiester bonde. other:_
- 9. For the DNA segment with nucleotide sequence 5' TATCGC 3', how many hydrogen bonds in total hold the base pairs between this segment and its complementary strand? A. 5 В. 6 С. 15 D. 18 E. Cannot be determined 10. What is the relation between the Fischer projection of two molecules below? H- HO- Но- Но H- HO- HO H- HO- H- -HO- Но -H- ČH2OH ČH2OH А. С2 ерimers В. СЗ ерimers C. Enantiomers D. Anomers E. Superimposable molecules Section B: True / False A group is deprotonated when its pKa value is lower than the pH of 1. T or F the solution. 2. a and ß configurations are used to describe enantiomers. T or F 3. Hydrogen bond can be formed between two peptide bonds. T or F 4. A single strand of RNA has 20% U so it also has 20% A. T or F 5. Arginine's pI lies between 2.34 and 9.6. T or F 6. w-6 fatty acids have fewer double bonds than w-9 fatty acids have. T or F 7. The net charge of glycine changes at different pH. T or F 8. The hydroxyl group in threonine is deprotonated at high pH. T or…nt #2 nt #3 nt #4 3. In the following sequence, which of these nucleotides a. would have a free triphosphate group extending from one of the carbons of their sugars? b. would have a free hydroxyl (OH) group extending from the carbon of their sugars? nt #1 5'-GCAT-3' 3'-CGTA-5' nt #8 nt #5 nt #7 nt #64. Draw and name the covalent linkage between two deoxynucleotides. Indicate both the 5’ and 3’ end. You should include all relevant atoms, though for the bases you may simply put the one-letter abbreviation instead of a drawing.
- 1. If you were to write the amino acid sequence of the polypeptide segment using one-letter abbreviations, the first two letters in the sequence would be ___. Note: For the tripeptide valylglycyltryptophan, its sequence in one-letter abbreviations will be written as VGW.Choices: EA DA AG AH GA 2. If this segment were to form an ?α-helix, the oxygen atom inside the red box will hydrogen bond with which of the indicated atoms? Write the letter pointing to the atom. [hbond_partner]Choices: A B C D E F1. What is the IUPAC name of cytosine?A. 2,4-dioxypyrimidineB. 2-amino-6-oxypurineC. 4-amino-2-oxypyrimidineD. 5-methyl-2,4-dioxypyrimidine2. The types of intramolecular bonds in nucleic acid include the following EXCEPT:A. Hydrogen BondB. Electrostatic interactionC. Phosphodiester bondD. Glycosidic bond3. What intermolecular bond has the greatest influence on the coiling of DNA to the histone complex?A. Electrostatic interactionB. Covalent bondC. Van der Waals interactionD. Phosphodiester bond4. The following rules on aromaticity promotes a planar structure of nitrogenous bases EXCEPT:A. All atoms in the ring are sp2 hybridized.B. Pi bonds show conjugation.C. The structure is cyclic.D. The number of electrons satisfies Huckel’s Rule.5. Which parts of Adenine are involved in the formation of hydrogen bonds with its complementary base pair?A. Atoms 1 and 6B. Atoms 9 and 6C. Atoms 3 and 4D. Atoms 2 and 41. For the nucleotide shown below, answer the questions below. NH, N. N. -0-P-O-CH, 0- H H H ОН OH