What is expected to happen to a suspended protein when the pH of the solution is adjusted to the protein's isoelectric point?
Q: xplain any five of the following terminologies: gene regulation, enhancer or silencer sequences,…
A: Introduction: Genomics is an area within genetics that is associated with the sequencing and…
Q: complete the sentence with a preposition ( in , at, on) or (no preposition) I phone you. five…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: For questions #23 - #27 A solution is made by dissolving 6.26g NAOH in 25.2g water. 19. What is the…
A: The number of moles of any compound is found by making use of formula: number of moles=given…
Q: The following plasmid is digested with EcoR1 and Ndel restriction endonucleases. Agarose…
A: Restriction endonucleases are enzymes which cleave the phosphodiester bonds within a DNA. These…
Q: Compare and contrast some of the artificial sweeteners:aspartame,saccharin, sucralose, erythrol
A: Artificial sweeteners are used for sugar replacements. This sweetener provides a sweet taste to…
Q: Glucose transporter allows glucose to move only in one direction to prevent loss from the cells.…
A: Permeability barrier and semi permeability of cell membrane are both maintained by lipids.…
Q: In a study, an undergraduate student discovered a new enzyme involved in the metabolism of…
A: Enzymes are usually protein molecules which catalyzes several biochemical reactions. It works as a…
Q: Which of the following components are found in lipoproteins? Choose all that apply a. DNA b.…
A: Lipoproteins are essential components of the body that transport nutrients around. Lipoproteins are…
Q: what are the dietary fats, and what are the dietary fat food and calorie densed beverage that lead…
A: Fats are made up of glycerol and fatty acids. Fats are classified into two types, saturated and…
Q: Antagonist binds to the enzyme at a site far away from the receptor site to inhibit the function of…
A: Glycolysis converts glucose to pyruvate which is then oxidized to carbon dioxide and water by the…
Q: Name and describe the four weak chemical interaction that occurs in biomolecules.
A: Biomolecules are the essential organic molecules, which are involved in the maintenance and…
Q: In the Krebs Cycle (Citric Acid Cycle), A 4-carbon compound with a 2-carbon unit to yield a 6-carbon…
A: Kreb cycle/ tricarboxylic acid cycle/ citric acid cylce - occur in matrix of mitochondria.
Q: Velocity (mM/min) [S], mM Uninhibited Inhibited 1.75 1.94 1.38 2.17 2.26 1.67 3.00 2.85 2.13 5.50…
A: Enzyme kinetics are studied using Michaelis Menten equation. This equation is as below: V = VmaxSKM…
Q: A) Determine Vmax and Km of the reaction in the absence of inhibitor. B) Determine the inhibition…
A: Enzyme kinetics - it is a study of enzyme catalyzed chemical reactions in which reaction rate is…
Q: If a cell sample is placed in pure water, what is the concentration of the salt inside the cell?…
A: The water move inside the cell and outside the cell through the process of osmosis. If a cell is put…
Q: Why do alcohol and water separate in DNA extraction process?
A: DNA extraction is defined as a process that is used widely for carrying out the purification fo DNA.…
Q: depletion of NAD+
A: Nicotinamide adenine dinucleotide ( NAD) is a coenzyme central to metabolism. It is found in all…
Q: olysaccharides are healthier for the body than mono- or disaccharides are. What choices could you…
A: Starchy carbohydrates are also referred to as polysaccharides. Rice and potatoes are examples of…
Q: In your own words, discuss the phenomena occur during the resting state and active state until the…
A: Neurons are the basic structures and functional units of the nervous system. The axon or the nerve…
Q: for GABA transaminase, ornithine decarboxylase, and alanine
A: PLP-dependent enzymes catalyse a wide range of reactions that result in bond cleavage at the carbons…
Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…
A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…
Q: Please describe the protein purification process with the aim of purifying a protein which locates…
A: We will answer the first question since the exact one was not specified. Please submit a new…
Q: Step 3: the phosphorylation of fructose 6-phosphate, is the first committed step of glycolysis. This…
A: Phosphofructokinase catalyzes the third step of glycolysis, in which it converts…
Q: Lipid molecules contain either saturated or unsaturated fatty acids. You may have seen different…
A: Molecular structures containing fatty acids have an alkane ring and an acidic carboxylic group…
Q: Choose all that aplly that are TRUE for the lipid bilayer: Negative mark is given to incorrect…
A: A lipid bilayer is described as a very thin layer that is made up of two different layers of…
Q: What is the role of the substrate? Is it really necessary to add substrate in ELISA?Explain why, or…
A: The antibodies that can specifically bind to an antigen can be used for the detection of the…
Q: hich of the following play an important role in synthesis of DNA/RNA: a.B-12 b.Folic acid c.Sodium…
A: The RNA is synthesized by RNA polymerase enzymes from a DNA template through DNA transcription.…
Q: What is the MAJOR product of the reaction catalyzed by rubisco in the Calvin cycle? Select one:
A: The Calvin Cycle is the part of the light independent reactions of photosynthesis, that widely uses…
Q: Given the following pKa data for the individual amino acids, estimate the pI for the tripeptide…
A: In the given data pKa of amino acids Thr-Asp-Arg is: Thr-? Asp-3.86 Arg-12.48 N-terminal group-…
Q: Write the reactions of the TCA cycle, naming all enzymes and providing the structural formulas of…
A: TCA cycle ( tricarboxylic acid cycle) is also known as citric acid cycle or Krebs cycle. It occurs…
Q: explain Role of telomere in disease give a diagram
A: A telomere is a region at the ends of linear chromosomes that contains repeating nucleotide…
Q: 3. The overall result of glycolysis can be summarized by the equation on the right in which the…
A: Glycolysis is oxidative metabolism of glucose molecule by formation of pyruvate which enters into…
Q: If an amino acid weighs 100 Da, and the protein contains 70 amino acids, what is the weight of the…
A: Amino acids are the building blocks of proteins. Multiple amino acid units are joined together to…
Q: In Zak-Henley's method in Determination of Total Serum Cholesterol, describe the role of Kiliani's…
A: Zak-Henley method is used for the determination of total serum cholesterol levels. Kiliani reagent…
Q: The following bond makes bovine pancreatic trypsin inhibitor as one of the stable proteins.…
A: Introduction: Bovine pancreatic trypsin inhibitor (BPTI) binds to trypsin and prevents peptide…
Q: Monosaccharides can be obtained not only from dietary carbohydrates but other major sources include…
A: Monosaccharides is a one of the type of carbohydrate. Monosaccharides are also called as simple…
Q: Which isomer- (R)-arginine or (S)-arginine is D-arginine? O (R)-arginine O (S)-arginine Submit…
A: Isomers are molecules with same molecular formula and different arrangement of atoms. Enantiomers…
Q: Dietary factors associated with increased risk for obesity are increased dietary fat intake and…
A: Obesity and overweight occurs when the amount of calorie that we take via food exceed the bodies…
Q: Complete the table
A: Polysaccharides is one of the important component in living organisms, which is found many diverse…
Q: Which characteristic is shared by the ring forms of the given monosaccharides? * CH2OH CHO O= H- HO-…
A: Ring forms of monosacharides are formed by reaction of aldehyde or ketone functional group with one…
Q: Describe the common strategy (steps) for protein sequencing, starting with a biological sample…
A: Proteins are one of the 4 major biomacromolecules. Proteins are the most abundant of the 4…
Q: 2. The two diagrams to the right il- lustrate plots of steady-state ki- netic studies to…
A: Phosphofructokinase adds a phosphoryl group from ATP to Fructose 6 phosphate (F6P) to yield Fructose…
Q: Currently available INSULIN PRODUCTS/MEDICATIONS in the market: Brand Name Route Onset (min.)…
A:
Q: 87) For a the viral proteins a. If the viral protein is made in the RER, it will go back to the…
A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…
Q: NH NH но но NH HO но Deoxythymidine Zidovudine Stavudine
A: Nucleoside polymerase inhibitors are glycoside analogs that inhibit the action of the catalyst…
Q: Table Q1(a) shows typical values for the intracellular and extracellular concentrations of the major…
A: All cells have an electrical potential difference or membrane potential across their plasma…
Q: Trace the pathway of a protein from translation to the plasma membrane. You may name this protein…
A: Membrane proteins are a part of membrane structure, which are very important for a cell to carry out…
Q: Which of the following is a carbohydrate?
A: Carbohydrates are one of the most important component of diet, it is major energy source for…
Q: What is the purpose of the low temperature step in the PCR reaction? a. To allow DNA polymerase to…
A: The denaturation step of PCR is optimized for high temperatures. The annealing step in PCR is…
Q: Most phages that use DNA to propagate work by hijacking host bacterial machinery including RNA…
A: PhiKZ is a giant bacteriophage of Pseudomonas aeruginosa.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Proteins are usually least soluble in water at their isoelectric points. Explain.The addition of ethanol, CH3CHOH, t an aqueous solution lowers the surface tension of the solution. Predict whether adding ethanol to an aqueous protein solution will tend to stabilize or unfold the protein. Briefly explain.What is meant by the isoelectric point of a protein?
- The protein gamma globulin has an isoelectric point of 6.60. Suppose you did a pH titration of a solution containing gamma globulin. At what pH will the protein aggregate?Define and give description of the importance of the isoelectric precipitation of proteins.Given a stock protein solution with a concentration of 6 mg/ml, determine the protein concentration of a solution made by mixing 5 μl of the stock with 5 μl of a buffer.
- At isoelectric point , what is the net charge of amino acids?The greatest buffering capacity at physiological pH would be provided by a protein rich in which of the following amino acids? Choose one from among the possible answers and explain. Serine Cysteine Alanine HistidineMost protein dissolve in neutral salt solution, is that true? Provide reasoning
- What determines whether a solution isacidic or basic?b) The likelihood of both triglycerides and phospholipids to behave as liquids at a given temperature is affected by their degree of saturation. Explain what saturation is and provide a biochemical explanation for why it affects the likelihood of a lipid to behave as a liquid at a given temperature. 5) a) Proteins have multiple "levels" of structural complexity. Match the type of chemical bond on the left with the level of protein structure that they are specifically involved in maintaining on the right. (Note that more than one letter may apply to each structural level and that each letter may be used more than once or not at all). a. disulphide bonds Tertiary structure b. hydrogen bonds Primary structure c. ionic bonds Quaternary structure d. peptide bonds Secondary structureAquaporins are proteins embedded in the plasmamembrane that allow water molecules to move betweenthe extracellular matrix and the intracellular space.Based on its function and location, describe the keyfeatures of the protein’s shape and the chemicalcharacteristics of its amino acids.