3. The Watson-Crick model pictures DNA as as the step. spiral staircase with the as the handrails and the
Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…
A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…
Q: functions. The structure that provides high processivity (processivity factor) is represented by the…
A: Letter A denotes core polymerase enzyme B denotes tau protein C denotes gamma clamp loader D denotes…
Q: Draw a stretch of DNA that would code for the amino acid "lysine". Be sure you draw all the…
A: The given structure is shown below.
Q: 5. There are huge amount of DNA in human that are not genetic sequence. Categorize them. The…
A: Minisatellites: They are repetitive sequences of DNA. Repeat length is 10-60 base pairs. Repeated…
Q: What was the purpose of transferring the +DNA and -DNA tubes from ice to hot water bath to ice…
A: Heat shock is the method use for transformation of plasmid DNA into Ecoli. It consists of a foreign…
Q: The sequence of bases in DNA can be altered by chemicalmutagens. These cause changes by:(a) Acting…
A: Mutagens : These are chemical compounds or radiations like UV or X ray which cause irreversible and…
Q: 1. Provide one reason to support the creation of a national DNA database and one reason to refute…
A: DNA or deoxyribonucleic acid is the genetic material in all living organisms. Within the cells, DNA…
Q: 6. Describe the process of DNA sequence of interest detection, using these term appropriately,…
A: *DNA sequencing is a technique used to find the exact sequence of bases like Adenine, Guanine…
Q: The BLAST program is a tool fora. inserting many DNA fragments into a cell at the same time.b.…
A: With the formation of molecular biology as a branch of science, scientist began to work on the…
Q: 4. Give the importance of Genomics especially in human. What are the different techniques in…
A: A genome is an organism's whole collection of DNA. The genomic DNA sequence is held within an…
Q: 3.Write the role of each of the following substances in the DNA extraction (Hint: page 98 of the lab…
A: a) Role of alcohol in DNA extraction DNA is soluble in water and insoluble in alcohol, so alcohol is…
Q: 4. The image below is based on the Meselson Stahl experiment where bacteria are grown in 15N and…
A: The Meselson-Stahl experiment showed that DNA replication is a semiconservative process. In this…
Q: you performed a sanger sequencing on a particular segment of DNA. Explain at the molecular level…
A: Effect on gel profile when we either forgot to add ddNTPs Or add more ddNTPs in test tubes during…
Q: 9. You have two tubes, each containing a different DNA fragment. The fragments are the same…
A: Restriction enzymes are those which cut DNA at a specific location called as restriction site.
Q: 2. How different would your DNA be if you had an identical twin? 3. Imagine that you are a forensic…
A: Identical twins are also known as monozygotic twins. They result from the fertilization of a single…
Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…
A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…
Q: The purpose of using a washing soap in DNA extraction experiment is to O a. Lyse the cells to…
A: DNA extractions is a method to isolate DNA from the nucleus of given cell culture. The four steps of…
Q: The diagram below shows an autoradiograph ofa DNA sequencing gel. Write the 5' to 3' sequence of the…
A: DNA sequencing is a method used to determine the organism’s actual DNA. The most commonly used DNA…
Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…
A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…
Q: 3. Give a schematic diagram of the different steps involved in PCR (Polymerised chain reaction) of a…
A:
Q: To test you further whether you understand the processes involved in the Central Dogma of Molecular…
A:
Q: 3. A long DNA will be divided into small fragments, and one of them will be attached to the bead and…
A: Ion torrent sequencing is the method of sequencing by signals of pH change voltage generation, which…
Q: 3. Primer Design You are analyzing the
A: Primer is a short stretch of oligonucleotide which is designed to copy the gene sequence of interest…
Q: 5) Which of the following is not a component of a PCR reaction mixture? A) DNA template B)…
A: Polymerase chain reaction (PCR) is a widely used method in molecular biology that is used to make…
Q: Describe the experiments done by Hershey and Chase That Verified That DNA was the genetic material.…
A: Introduction: Researchers determined that the element responsible for the transmission of features…
Q: Based on the following image: A) Identify the largest DNA fragment in sample 5. Explain your…
A: In the given question, an agarose gel is shown which is having bands of DNA in different lanes. DNA…
Q: 2. A. B. C. The DNA of each species has a different base composition. Find the base composition of…
A: Nucleotide subunits made up DNA's structure. Deoxyribose along with a phosphate group, and one of…
Q: he purpose of using a washing soap in DNA extraction experiment is to D a. Cut the proteins away…
A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell It stores genetic…
Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…
A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG
A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…
Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…
A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…
Q: You have this sequence of DNA from leading strand: GGCATGCGA From this you know: * O G is the 5'end…
A: DNA acts as genetic material in all living organisms. During replication of DNA, at each replication…
Q: 4. Create a PCR master mix for the following: 48 samples, 25 uL total volume per reaction, 2 uL…
A: PCR, or the polymerase chain reaction, is a chemical reaction that is used by molecular biologists…
Q: Researchers, troubleshooting PCR, ran their DNA through different temperatures to ascertain when…
A: DNA melting point DNA melting point is the temperature at which the double helix of DNA is meltdown…
Q: 1 DNA evidence analysis is an imperfect science. Provide two reasons why this may be the case.
A: DNA is the hereditary material present in organisms. It is important for our growth, reproduction,…
Q: our lab is preparing some samples for analysis and loses the labels on the tubes. The samples…
A: A nitrogenous base is a molecule that contains nitrogen and has the chemical properties of a…
Q: 1. Provide one reason to support the creation of a national DNA database and one reason to refute…
A: There are many biomolecules, including carbohydrates, protein, lipids, nucleic acid, etc., present…
Q: Which of the following is/are not required for DNAreplication to occur?a. DNA polymerase d.…
A: DNA (short for deoxyribonucleic acid) is a double helical structure (with two DNA strands). A…
Q: The Southern blot procedure was developed số that: DNA fragments that have been subjected to…
A: Answer 1) : Option " 1 " is correct : DNA fragments that has been subjected to electrophoresis…
Q: 1) The Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent…
A: DNA extraction aids in the study of the genetic origins of different illnesses. For the development…
Q: Which of the following DNA has a high G-C content? (Tm refers to the melting temperature of the DNA.…
A: In double stranded DNA the adenine binds with thymine and guanine binds with cytosine. This four…
Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…
A: Fill in the blank the question. Average weight of one DNA base pairs= 650 Dalton. 1 Dalton =…
Q: The hybridization between DNA during the library screening process take place between probs and cDN…
A: b. hydrogen bond between the complementary DNA sequence
Q: 3- Which of the following is not a basic requirement of PCR? a-Taq DNA polymerase b-DNA Probes…
A: Polymerase Chain Reaction (PCR). Principle: When a double-stranded DNA molecule is heated to a high…
Q: 1. List all the differences between the DNA Polymerase Reaction and Polymerase Chain Reaction (PCR)?
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…
A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…
Q: 3. The Watson-Crick model pictures DNA as a as the step. spiral staircase with the as the handrails…
A: The double helical structure of DNA was first proposed by James Watson and Francis Crick. According…
Q: 4. Why do you need to perform PCR on DNA evidence from a crime scene?
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: DNA was extracted from a bacterial species. The proportion of cytosine was found to be 30%, then…
A: There are four nitrogenous bases present in the DNA molecule. These are adenine, guanine, thymine,…
Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
Step by step
Solved in 3 steps
- 2. Given the mRNA for a protein: 5'–CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' Write the amino acid sequence a. For the protein synthesized from this MRNA. b. When U substitutes for C. substituted by U 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU-- 3' c. When C is deleted. deleted 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU --- 3' d. What type of mutation is illustrated in c?2. Dr. Kim at Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 1) САСТС ССAGT GTACC T 3) GGAGT CAATC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCCGA G 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GСТTG G 12) TGCTT GGAGT (a) Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…2. Dr. Kim at Ewha Research Center performed shotgun Sanger sequencing on an unknown DNA sample, and obtained the following reads (12 reads). Since the length of each read is quite short, Dr. Kim ran the original sample in a gel electrophoresis, and realized that the original DNA is just 50 base pairs long. (Please note that the resolution of gel electrophoresis is not so good. Thus, we cannot figure out the exact length of DNA using gel electrophoresis in the real world.) 1) САСТС ССAGT GTACC T 3) GGAGT CAАТC GC 5) GGCTG TGCTT GG 7) GATGG CTGTG 9) CAGTG TACCT GCA 11) TGCAA GCGA G 2) AGCCG AGATG GCTG 4) CTGCA AGCCG A 6) CTTGG AGTCA ATCGC 8) САСТС ССAG 10) GCTGT GCTTG G 12) TGCTT GGAGT (a} Find the sequence of the original DNA (reconstruction), and align each read with the reconstructed DNA sequence. (hint: put all reads on a ppt slide, and move them around to find overlaps.) (b) Calculate coverage at each nucleotide position of the reconstructed DNA, i.e., how many reads cover that…
- 1. Using the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing cut fragments would appear. The linear uncut DNA is 640 base pairs in length. Insert an image below.4. Explain why Maurice Wilkins and Rosalin Franklin needed to use X-rays (instead of visible light) when "taking pictures" of crystalized DNA.3. Using Chargaff's rule of base pairing determine the amount of guanine in 120 bp long fragment of double strand DNA if there are 45 adenines present.
- 16. The process of attaching biological functions to DNA sequences is called?1. Write the complementary base sequence for the matching strand in the following DNA section: -A-G-T-C-C-A-A-T-C–1. Draw a chromosome and a pair of homologs (or homolog pairs, or homologous chromosomes). Label on the chromosome and homologous pair; the centromere and sister chromatids. In each of these drawings explain how many and where are the Watson and Crick double strand DNA molecules.
- 3. Hydrogen bonds are quite weak compared to covalent bonds. Explain why this fact is actually advantageous to DNA in its role as the hereditary material in cells.✓21. highly methylated DNA is active while less methylated DNA is inactive true or false12. You are working with a picce of DNA of the sequence: 5'-TATTGAGCTCCCCGGAT-3 3'-ATAACTCGAGGGGCCTA-5 You cut the above piece of DNA with a restriction enzyme that recognizes the sequence 5'GAGCTC and cuts on the 3' side of the A within this sequence. Please, draw all products that you get after digestion. Label all 5' and 3' ends.