Researchers, troubleshooting PCR, ran their DNA through different temperatures to ascertain when melting of the strand occurs. The detail from their experiments is summarized in the graph below. What is the melting temperature of the solution? Indicate the points on the graph which correspond to the DNA in single stranded (SSDNA) and double stranded (dsDNA forms). 1 DNA30melt vs. Temp untitled it 1 0.9 0.8 0.7 0.6 0.5 0.4E 0.3 0.2 0.1 10 20 30 40 50 60 70 80 Temp DNA30melt

Researchers, troubleshooting PCR, ran their DNA through different temperatures to ascertain when melting of the strand occurs. The detail from their experiments is summarized in the graph below. What is the melting temperature of the solution? Indicate the points on the graph which correspond to the DNA in single stranded (SSDNA) and double stranded (dsDNA forms). 1 DNA30melt vs. Temp untitled it 1 0.9 0.8 0.7 0.6 0.5 0.4E 0.3 0.2 0.1 10 20 30 40 50 60 70 80 Temp DNA30melt

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 5CT: Translate the .sequence of bases in the previous question, starting at the second base.

See similar textbooks

Similar questions

22.124 Give two reasons why bacterial cells am wred for recombinant DNA procedures. Nucleic Acids 1015 22.125 What role do plasmids play in recombinant Polymerase Chain Reaction (Section 22.15) 22.131 What is the function of the polymerase chain DNA procedures? 22.126 Describe what occurs when a particular restric- reaction? tion enzyme operates on a segment of double- stranded DNA. 22.127 Describe what happens during transformation. 22.128 How are plasmids obtained from E, coli bacte- 22.132 What is the function of the enzyme DNA polymerase in the PCR process? 22.133 What is a primer and what is its function in the PCR process? 22.134 What are the four types of substances needed to carry out the PCR process? ria? 22.129 A particular restriction enzyme will cleave DNA Sequencing (Section 22.16) DNA between A and A in the sequence AAGCTT in the 5'-to-3' direction. Draw a dia- gram showing the structural details of the "sticky ends" that result from cleavage of the following DNA segment.…
12:49 0 14. You want to amplify the DNA between two stretches of sequence shown in the figure below. Explain which one of the following primer pairs would allow you to amplify the DNA by PCR. DNA to be amplified 5'-GACCTGTGGAAGC -CATACGGGATTGA-3" 3'-CTGGACACCTTCG GTATGCCCTAACT-5" primers (1) 5'-GACCTGTCCAAGC-3 (2) 5-CTGGACACCTTCG-3 (5) 5-CATACGGGATTGA-3" (6) 5°-GTATGСССТААСТ-3° (3) 5'-CGAAGGTGTCCAG-3' (7) 5'-TGTTAGGGCATAC-3" (4) 5'-GCTTССАСАGGTC-3° (8) 5'-TCAATCCCGTATG-3' END 5 THE END
A circular double-stranded DNA molecule contains 4200 base pairs. Insolution, the molecule is in a B-form helix, with about 10.5 base pairsper turn. The DNA circle has 12 superhelical turns. What is its superhelixdensity s?
Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.
0.5 104 10 102 10 1 10' 10² 103³ 10* Cot (mole × sec/L) In 1968, Britten and Kohne showed that once double-stranded DNA is dissociated into single- stranded pieces, the rate of reassociation of the complementary strands can be analyzed. For these kinds of experiments, the DNA is first sheared into fragments with an average size of several hundred base pairs. The fragments are dissociated (denatured) via heating, and then the sample temperature is lowered slowly while the reassociation is monitored. During reassociation, pieces of single-stranded molecules collide at random. If the pieces are complementary, a stable double-stranded molecule is formed. If no match is made, the pieces separate and continue encountering other single-stranded pieces. This process continues until all matches are made. a. The figure below shows an ideal time course for reassociation of DNA. Co is the initial concentration of DNA single strands in moles per liter. Time (t) of the reassociation is measured in…
11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1
For the following DNA sequence along a chromosome answer the following questions: The enzymes are working 5' ATGCATTAGACCACTAGCAT 3' left to right 3' TACGTAATCTGGTGATCGTA 5' 14. What enzyme copies the DNA by adding DNA nucleotides? 15. What enzyme links Okazaki fragments together on the lagging strand?
1 2 3 4 (kbp) (bp) 4. To the right is an image of an agarose gel. Lanes 1 and 4 are DNA markers (DNA sizes are known) and serve as a reference to estimate the size of DNA fragment of interest in Lane 2 and 3. 4.36 2.32 a. What is the approximate size of the fragment in lane 2? Pay attention to units! 500 -200 b. What is the approximate size of the fragment in lane 3 (near the bottom)? Pay attention to units!
The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your answers, show how you came up to each result?(a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in micrometer?
36/ 50 In the fece representing DNA replication, which letter represents the leading strand? AA C.C DD E None of the above
The technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the use of dideoxyribonucleotides(shown in Figures 20.5 and 20.16). A dideoxyribonucleotidehas a hydrogen atom attached to the 3′-carbon atom insteadof an –OH group. When a dideoxyribonucleotide is incorporatedinto a newly made strand, the strand cannot grow any longer.Explain why.
A typical bacterial DNA has a molar mass of 4 × 109 g m ol-1 . Approximately how many nucleotides does itcontain?