our lab is preparing some samples for analysis and loses the labels on the tubes. The samples originally came from a virus vith an RNA genome, a virus with a single stranded DNA genome, and a mammal with a double stranded DNA genome. You come up with a brilliant idea to quantify the nucleotide composition in each sample. Match the samples with the correct labe using the table below. %A %C 35 %T Sample 1 %G 15 %U 30 20 2 20 30 30 20 23 20 25 32 Бample 1 viral single stranded DNA genome Sample 2 mammalian double stranded DNA genome Sample 3 viral RNA genome

our lab is preparing some samples for analysis and loses the labels on the tubes. The samples originally came from a virus vith an RNA genome, a virus with a single stranded DNA genome, and a mammal with a double stranded DNA genome. You come up with a brilliant idea to quantify the nucleotide composition in each sample. Match the samples with the correct labe using the table below. %A %C 35 %T Sample 1 %G 15 %U 30 20 2 20 30 30 20 23 20 25 32 Бample 1 viral single stranded DNA genome Sample 2 mammalian double stranded DNA genome Sample 3 viral RNA genome

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 17QP: Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?

See similar textbooks

Similar questions

A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane. What is it about the chemistry of DNA that causes it to be uniformly negatively charged?
A DNA sample contains 21% adenine. What is the complete percentage base composition?
A piece of DNA is cut into four fragments as shown below. A solution containing the four fragments is placed in a single well at the top of an agarose gel. Using the information given below, draw (below the well) how you think the fragments will be aligned on the gel following electrophoresis. Label each fragment with its corresponding letter. Remember, each band on the gel will be the same width, equal to the width of the well at the top of the gel. These should all be in one lane. What if you had two different DNA fragments that were exactly the same length as measured in base-pairs. Would it be possible to distinguish them using this type of electrophoresis? How would they appear on a gel?
Show the separation pattern of the following DNA molecules on 1 % agarose gel. Justify your results. 5 kbp 5 kbp 5 kbp 5 kb +
A DNA sample contains 21% adenine. What is its completepercentage base composition?
In a sample solution given to be analyzed;CATAGCTTTGTTAAA (DNA nucleotide chain). Show the 5 'and 3' ends by writing in triplet (codon) form. Find the number of Hydrogen bonds in the double helix DNA strand at the beginning.
Shown is a sequencing gel. Read the sequence off the gel and determine the first 4 nucleotides (or bases) based on the fact replication occurs 5¹ to 3¹. A I G C Answer:
Watch the demonstration video on nucleic acid quantification on the NanoDrop spectrophotometer: https://cutt.ly/bio150dnaquantification Note: the video is entitled RNA but the method is identical for DNA quantification. 1. At what ratio of A260/280 can we say that DNA is pure? What about RNA and protein?2. While spectrophotometric methods are effective at detecting DNA, a more sensitive but expensive technique called fluorometry is used in sensitive applications. What is the principle behind fluorometry and why is it better than spectrophotometry in detecting DNA?
On the image below what is the next nucleotide to be added on the oldest Okazaki fragment (use picture)? A C G T
The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted portion of the sequence is where a primer will bind during polymerase chain reaction (PCR) replication. Which of the following options best represents the primer?5’ – CGCGTATCGGGCTGTCGCGTCTTGCAGCTCG – 3’ a. 5’ – CGAUACGC – 3’ b. 5’ – CGATACGC – 3’ c. 5’ – CGAGCUGC – 3’ d. 5’ – CGAGCTGC – 3’ e. None of the above
You are working in a research lab studying human Peptide Z, which is a short protein that plays a key role in responding to SARS-CoV-2 virus infection. Your advisor gives you the double-stranded DNA sequence encoding Peptide Z (below), but she neglects to tell you which are the coding and non-coding strands of this DNA before leaving on a six-month sabbatical. 5'-AGA CCC ATG CCT CAG CAG TTC TTT GGA TTA ATG TAA-3' 3'-TCT GGG TẠC GGA GTC GTC AAG AAA CCT AAT TẠC ATT-5' Using your understand of transcription, translation, and the codon table below, determine if the top strand or bottom strand is the template strand of the Peptide Z gene. (Enter either top strand or bottom strand.) What is the sequence of the RNA that encodes Peptide Z? Note that the entire DNA sequence is transcribed. 5' - - 3' What is the amino acid sequence of Peptide Z? Make sure you indicate the carboxyl-terminus and amino-terminus with C and N, respectively.
Write out the DNA sequence using the following instructions: This is a double stranded DNA hydrogen bonding with each other following the principle of complementary base-pairing Each strand contains ten nucleotides Each strand contains all four different types of nucleotides You should indicate clearly the directionality of each strand in your answer You do not need to draw the full nucleotide structure. Use the one-letter code (A, T, G, C, or U) to represent each nucleotide