Suppose the coding (sense) strand of some DNA has this base sequence: 5-GATGTATA-3' Write the base sequence of the mRNA that would result from transcription of this DNA.
Q: The Ki for a competitive inhibitor pyrrole-2-carboxylate is 0.05M. Calculate the initial velocity if…
A: A form of enzyme inhibitor known as a competitive inhibitor pits the substrate against the enzyme's…
Q: The pharmaceutical applications of the compound shown HO OH OH OH OH O A. Chemical substrate for…
A: Sorbitol less commonly known as glucitol.It is a sugar alcohol with a sweet taste which the human…
Q: Note: the reaction volumes will be 20 μL and n = 10 reactions! Assume you extract gDNA quantitated…
A: Genomic deoxyribonucleic acid (abbreviated as gDNA) represents chromosomal DNA. This DNA is in…
Q: Finish the sentence alpha helical secondary structures in proteins Are connected by peta- turns Are…
A: Secondary structure is the ordered arrangement or conformation of amino acids in localized regions…
Q: yruvate carboxylase catalyzes the first step of gluconeogenesis. ATP + HCO3─ + pyruvate →…
A: Actual free energy change is related to standard free energy change by the following mathematical…
Q: RNase Q is an enzyme that has identical activity to RNase A, but is found only in a group of humans…
A: There are four classes of biological macromolecules: nucleic acid, proteins, lipids and…
Q: Why are closure and completeness important in genome seq
A: Closure and completeness are two critical aspects in genome sequencing that play a fundamental role…
Q: 1. What type of reaction occurred when the samples (enumerated) reacted with the Molisch reagent?…
A: As per Bartelby guidelines, an expert cannot answer more than one question. Kindly submit other…
Q: 200 microliters of a standard solution of 0.200 mg/mL caffeine was mixed with 4.8 mL of 50 mM sodium…
A: Equation of dilution: M1 × V1 = M2 × V2where:M1 is the molar concentration of the stock solution.M2…
Q: Which of the following statements describes one reason that plant oils are generally healthier for…
A: Plant oils are liquid fats extracted from various plant sources, such as seeds, nuts, and fruits.…
Q: What might happen to someone if their cells no longer recognized ghrelin's message? they would never…
A: Ghrelin is a hormone produced mainly by the stomach and, to a lesser extent, by other tissues in the…
Q: The diagram to the right illustrates in panel A the N- acetyl-glutamate content of rat livers as a…
A: When amino acids are degraded in the tissue, they release ammonia. Ammonia is toxic to the cell so…
Q: Dimethoate is a commonly used agrochemical. However, chronic exposure to it can cause an individual…
A: Hyper-ß-alaninemia is a condition characterized by excessive alanine in the muscles. In the context…
Q: II. While there are many different types of inhibitors, most have a very similar structure so they…
A: Enzymes are high molecular weight protein that catalyse biochemical reactions. They contain a active…
Q: Part B. Classify Fatty Acids as Saturated or Unsaturated 2. Identify each fatty acid below as…
A:
Q: Membrane-spanning proteins are notoriously difficult to characterize by x-ray crystallography.…
A: The biological membranes consist of a bi-layer of phospholipid molecules.In addition, there membrane…
Q: Which of the following represents a pair of epimers? A Н- Н- OH с -OH H-C-OH H-C-H OH О C-H H-C-OH…
A: The isomers that differ only at one chiral centre in the arrangement of -OH group are called…
Q: Draw the peptide ASK(ala-ser-lysine) with proper stereochemistry? what is its pI(isoelectric…
A: Given peptide is ASK( alanine- serine- lysine).The peptide is planar due to the partial double bond…
Q: 1. The following data were obtained for a competitive inhibition study in which the [I] = 3 µM for…
A: In competitive inhibition, only the apparent Km is affected (Km,app> Km),The Vmax remains…
Q: Draw the product of the dehydration reaction of the B- hydroxyacyl-SACP catalyzed by…
A: Fatty acid synthesis is the process of creating fatty acids from acetyl-CoA and malonyl-CoA in the…
Q: Why must NH3 be transported as part of an amino acids vs. being released into circulation? What…
A: Ammonia is produced in all tissues of the body during the metabolism of amino acids and other…
Q: The following is [Select] [Select] CH OH OH OH OH V glycosidic bond. CH₂OH О OH ОН disaccharide with…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula:…
Q: ANSWER THE FOLLOWING PROBLEM AND EXPLAIN YOUR ANSWER FOR BETTER UNDERSTANDING. No. 3. Which Amino…
A: There are four classes of biological macromolecules; proteins, nucleic acid, lipids and…
Q: Frog muscle cells and the solution bathing the cells contain ions at different concentrations. The…
A: The concentrations of Na+, Ca2+, K+, and Cl- are shown in the following table. Temperature = 25…
Q: The energy yield for acetyl CoA in the fatty acid oxidation of a 16 carbon chain (16:0) is…
A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β- oxidation of…
Q: Sort the following steps of GPCR signal propagation (you may not use all the steps): A)…
A: G protein coupled receptors are protein receptors that are found closely associated with G proteins…
Q: create a table to summarize the ATP count for the listed carbohydrates below that will undergo…
A: The difference between the aerobic breakdown of sugars in liver, kidney & heart v/s muscle &…
Q: Classify the phrases. Does each phrase describe a kinase, a phosphatase, neither, or both? Kinases…
A: Proteins are regulated by adding or removing phosphate groups. These are crucial for the…
Q: An organism no longer needs to express a particular gene. What is one strategy it might use of the…
A: Genes are segments of DNA that can be translated into functional proteins. The collective process of…
Q: 9. What are the primary differences between site-specific recombination and general recombination?…
A: Recombination is the process of reshuffling genetic material to create new combinations of genes…
Q: A mutation of Lysine to Alanine in the middle of TM1 has been associated with increased GPCR…
A: The lipid bilayer is a thin polar membrane. It is made up of two layers of lipid molecules. The…
Q: 1a. Name and draw diagrammatically the series of mitochondrial electron transfer catalysts, starting…
A: ETC consists of four protein complexes called Complex I, II, III and IV that transport electrons…
Q: Which of the following is an important enzyme involved in the synthesis of cholesterol from isoprene…
A: Acetyl-CoA Formation: Cholesterol synthesis begins with the conversion of acetyl-CoA, a two-carbon…
Q: A peptidyl-tRNA in the P site has a strange modification with an ether versus an ester bond to the…
A: Answer :- The scenario with peptidyl-tRNA in the P site—a part of the ribosome involved in protein…
Q: concentration of hemoglobin in the system not bound resting tissues bound increase concentration of…
A: Transport of oxygen in blood depends upon hemoglobin. Basically hemoglobin has 4 subunits, 2 alpha…
Q: The protein catalase is an enzyme that catalyzes the decomposition of hydrogen peroxide: 2 H2O2 (aq)…
A: For a one-substrate enzyme reaction, the Michaelis-Menton equation shows the quantitative…
Q: 15. Write the metabolites of the following substrates due to phase Il reactions: a. b, R 20 R C. R R…
A: Enzymes are proteins that catalyze biochemical reactions. Enzymes sometimes require a non-protein…
Q: Why is Ketose dehydrated more rapidly than aldoses? what makes Ketose react faster than aldoses? Why…
A: Seliwanoff's test is used to differentiate between ketoses and aldoses. Here, the sample is heated…
Q: Remembering that the Pyruvate dehydrogenase complex and the alpha ketoglugarate complex catalyze…
A: Pyruvate is the end product of glycolysis. Under aerobic conditions, pyruvate is oxidised into…
Q: Indicate how the observed Km of an enzyme would change in the presence of inhibitors having the…
A: The Km is known as Michaelis constant, it is the concentration of substrate at which reaction…
Q: Fill the sentence in with the right keyword: Anabolic reactions Sometimes or Alwasys consume energy.
A: When a chemical reaction takes place energy is either taken in or released. Depending on the…
Q: What is the product after one round of beta oxidation for the trans-fatty acid attached below,…
A: Beta-oxidation is the metabolic pathway that breaks down fatty acids into acetyl-CoA fragments. It…
Q: 13. What was the old-fashioned, traditional test to determine carbohydrate composition, which…
A: There are four classes of biological macromolecules: nucleic acid, proteins, lipids and…
Q: Fehling's Test: Some sources say that Fehling's test will be positive only for Aldoses not for…
A: There are four classes of biological macromolecules; namely nucleic acids, proteins, lipids and…
Q: What type of linkage is shown here? CH₂OH H K ОН H ОН H O Alpha (1,4) O Beta (1,2) Beta (1,6) O…
A: The bond that link nks two monosacharide units in a carbohydrate is called glycosidic…
Q: 1a. If you wanted you could take a glucose molecule and convert it to pyruvate via glycolysis and…
A: Hello! Due to time constraints, we are able to provide the answer for the first sub part only. If…
Q: histidine
A: Histidine, an essential amino acid, fulfills diverse roles in biological systems, demonstrating…
Q: still don't understand how the final pH was calculated? I don't understand how with the pKa of 2.12…
A: Equation of Henderson-Hasselbalch: The pH of a solution is related to the pKa of the weak acid or…
Q: . List two compounds that can be produced from pyruvate in skeletal muscle b. What are the enzymes…
A: Pyruvate is a three-carbon molecule produced from oxidation of glucose. The process of oxidation of…
Q: Congratulations! Due to your success in Dr. Daniel's Cellular Metabolism class. You have been…
A: A reaction is said to be an oxidation reaction if it remove electrons. In other words, the oxidation…
![Suppose the coding (sense) strand of some DNA has this base sequence:
5'- GATGTATA-3'
Write the base sequence of the mRNA that would result from transcription of this DNA.
5'
3'
X](/v2/_next/image?url=https%3A%2F%2Fcontent.bartleby.com%2Fqna-images%2Fquestion%2Ff4fc94a3-a27f-4085-a477-3c30043bb77e%2F011a6272-57b1-41ef-b551-358c8c2a7d00%2F2qjcr_processed.jpeg&w=3840&q=75)
![](/static/compass_v2/shared-icons/check-mark.png)
Step by step
Solved in 3 steps
![Blurred answer](/static/compass_v2/solution-images/blurred-answer.jpg)
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
- A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.Here is a DNA template strand’s sequence and direction: 3’-TACGCGGTAATC-5’ . What is the sequence and direction of mRNA synthesized from this DNA?
- Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA, and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 3' TCACAATACAAAGGTGTACTGATCTCATCTCCATAA 5'Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the mRNA strand synthesized from this DNA?
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly
![Human Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
![Human Biology (MindTap Course List)](https://www.bartleby.com/isbn_cover_images/9781305112100/9781305112100_smallCoverImage.gif)
![Biology Today and Tomorrow without Physiology (Mi…](https://www.bartleby.com/isbn_cover_images/9781305117396/9781305117396_smallCoverImage.gif)
![Human Heredity: Principles and Issues (MindTap Co…](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)