Concept explainers
Using the DNA sequence 3′ TAC CAG ATA CAC TCC CCT GCG ACT 5′ illustrate and explain the following mutations:
- a. a deletion
- b. an insertion
- c. a substitution
- d. a nonsense mutation
- e. a frameshift mutation
a.
To explain: A deletion mutation by using DNA sequence.
Introduction:
Mutation in an organism is defined as a sudden alteration of “nucleotide sequences”. The mutations can be harmful, beneficial or neutral depending on the alteration in the genome and the effect exerted by the environment.
Explanation of Solution
Deletion mutation involves the removal of single base results in a frameshift mutation that changes the reading frame. Deletion mutation in given DNA sequence is:
b.
To explain:
An insertion mutation by using DNA sequence
Introduction:
The mutation causes an alteration in the nucleotide sequence of DNA. It is caused by natural as well as artificial factors. Mutagens are the agents that cause mutation in DNA. Mutation is a permanent change in the DNA sequence.
Explanation of Solution
The insertion mutation involves the addition of one or more nucleotide sequences in a gene that alters the sequence and results in changes the protein function. An insertion mutation in a given DNA sequence
c.
To explain:
A substitution mutation by using the given DNA sequence
Introduction:
Mutation is defined as a change in the sequence of genetic material either due to the mistake in replication or due to the changes in the environment. DNA enzymes have a property of proofreading which prevents any mistake in a nucleotide sequence. But sometimes some mistakes during DNA replication are undetectable. These alterations in the nucleotide sequences are known as mutation.
Explanation of Solution
It involves the replacement of one base pair of DNA with another. Such type of mutation is silent as the mutated gene encodes for the same protein as the original gene. It is also called missense mutation. Due to substitution, the shape of amino acids is changed and its function also changes. For example sickle cell anemia. A substitution mutation in a given DNA sequence
d.
To explain:
A non-sense mutation in a given DNA sequence
Introduction:
Mutation is a sudden unpredictable change in the DNA sequence. It causes an alteration in the sequence of DNA. It is caused by natural factors or by exposure to certain artificial mutagens.
Explanation of Solution
The nonsense mutation occurs when base triplet that codes for a specific amino acid changes into stop codon and terminates the process of translation. Non-sense mutation in a given DNA sequence is
e.
To explain:
A frameshift mutation in a given DNA sequence
Introduction:
Mutation is defined as the change in the nucleotide sequence of the gene which is results in a change in the coding of a different protein. Each codon codes for specific amino acid. It occurs due to physical and chemical mutagens.
Explanation of Solution
Insertion and deletion is a type of gene mutation which involves either addition or removal of one or more nucleotides bases from a sequence of DNA. Insertion and deletion mutation together lead to cause frameshift mutation. Insertion mutation occurs when nucleotides bases are inserted into the sequence of DNA whereas deletion mutation occurs when one or more nucleotide bases are deleted from DNA sequence. A frameshift mutation in DNA sequence
Want to see more full solutions like this?
Chapter 9 Solutions
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
- Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’arrow_forwardA small section of a gene for a protein has the following nucleotide sequence: TAT AGG GAC CTA TGT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first cytosine base with guanine base b. Replacement of final thymine base with guanine base c. Replacement of second guanine base with cytosine base d. Replacement of first thymine base with adenine basearrow_forwardA small section of a gene for a protein has the following nucleotide sequence:CTG GGA TCC TAA GGTWhich of the following mutations would cause a nonsense mutation in the sequence shown above? Select one: a. Replacement of second adenine base with a cytosine base b. Insertion of guanine base after the first thymine base c. Insertion of guanine base after the first adenine base d. Replacement of second cytosine base with a adenine basearrow_forward
- AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following: a. mRNA codons b. tRAN anticodons c. amino acidsarrow_forwardWhat type of mutation is shown below: CGG GGG GAG TCT TTT TAT GCA GCT changes to: CGG GGG GAG CTT TTTATG CAG CT A frame shift mutatuion which resulted from a deletion. O Point mutation in which one nucleotide was changed. O Point mutation in which a length of nucleotides were changed. O A frame shift mutatuion which resulted from an insertion.arrow_forward-Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG -If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTTarrow_forward
- A small section of a gene for a protein has the following nucleotide sequence: CCT AAG GAT TCA CTT Which of the following mutations would cause a missense mutation in the sequence shown above? a. Replacement of first guanine base with cytosine base b. Replacement of first thymine base with cytosine base c. Replacement of second thymine base with adenine base d. Replacement of seond guanine base with adenine basearrow_forwardConsider this sequence below: GAG TAC ACG AGT GGA Which of the following options is an example of a non-synonymous point mutation? (remember to translate to mRNA!) A. GAG TAC AAT CGA GTG GA B. GAG TAC ACG GGT GGA C. GAG TAC A–G AGT GGA D. GAG TAC ACG AGA GGAarrow_forwardBased on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forward
- Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’ a. What is the complementary strand? b.Deduce the mRNA in this coding region. c.What is the amino acid sequence based on this mRNA? d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardGiven is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this mRNA?d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?arrow_forwardA point mutation is a mutation that arises when one nucleotide in the genetic sequence is substituted, added or deleted. Two possible point mutations are given below: Mutation A. Lysine is substituted for Leucine Mutation B: Serine is substituted for Threonine Which mutation is likely to be more serious? E Explainarrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning