Concept explainers
Through a microscope, you can see a cell plate beginning to develop across the middle of a cell and nuclei forming on either side of the cell plate. This cell is most likely
- A. an animal cell in the process of cytokinesis.
- B. a plant cell in the process of cytokinesis.
- C. a bacterial cell dividing.
- D. a plant cell in metaphase.

Introduction:
Cell division takes place in two steps. The first step is the replication and segregation of the genetic material of the nucleus and that is called karyokinesis. The division of the cytoplasm is called cytokinesis.
Answer to Problem 1TYU
Correct answer:
Through a microscope, you can see a cell plate beginning to develop across the middle of a cell and nuclei forming on either side of the cell plate. This cell is most likely a plant cell in the process of cytokinesis. Therefore, option (b) is correct.
Explanation of Solution
Reason for the correct statement:
The cytokinesis occurring in a plant cell is identified by the development of a cell plate near the center of the cytoplasmic region. The cell plate is developed by the accumulation of the materials for cell wall generation near the middle of the cell wall. The cell plate merges with the plasma membrane to form the two daughter cells.
Option (b) is given as “a plant cell in the process of cytokinesis”.
“During the cytokinesis of the plant cell, the cell plate formation takes place”, so it is the correct answer.
Hence, option (b) is correct.
Reasons for the incorrect statements:
Option (a) is given as “an animal cell in the process of cytokinesis”.
The process of cytoplasm division in the animal cell takes place by the process of cleavage. So, it is a wrong answer.
Option (b) is given as “a bacterial cell dividing”.
The bacteria divide into two daughter cells by replicating the genetic material, followed by the narrowing of the plasma membrane inwards to form the two identical daughter cells. So, it is a wrong answer.
Option (d) is given as “a plant cell in metaphase”.
At the time of metaphase, the chromosomes are seen near the center of the cell. There is no formation of the cell plate in the plant cell. So, it is a wrong answer.
Hence, options (a), (b), and (c) are incorrect.
The cell plate is formed during the cytokinesis of the cell division in the plant cell. The cell plate merges with the plasma membrane and the two identical daughter cells are formed.
Want to see more full solutions like this?
Chapter 9 Solutions
EP CAMPBELL BIO.IN FOCUS AP-MOD.MASTER.
Additional Science Textbook Solutions
Physics for Scientists and Engineers
Genetics: From Genes to Genomes
Campbell Essential Biology (7th Edition)
HUMAN ANATOMY
Biology: Life on Earth with Physiology (11th Edition)
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning



