MICRO. FUND. CONNECT CODE W/VIRTUAL LAB
3rd Edition
ISBN: 9781266313806
Author: Cowan
Publisher: INTER MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 11Q
Examine the DNA triplets here and determine the amino acid sequence they code for. Then provide a different DNA sequence that will produce the same protein. TAC CAG ATA CAC TCC CCT
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Trending nowThis is a popular solution!
![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Give the mRNA and amino acid sequence from this DNA strand:
CCATTAACCTTACTGCTGGCTAAATTCGTTGCT
Translate this nucleotide sequence into an amino acid sequence.
Gene Sequence (5'-to-3'):…
Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA
TGTGCGCGCGGGGCG
Chapter 8 Solutions
MICRO. FUND. CONNECT CODE W/VIRTUAL LAB
Ch. 8.1 - Define the terms genome and gene.Ch. 8.1 - Differentiate between genotype and phenotype.Ch. 8.1 - Draw a segment of DNA, labeling all important...Ch. 8.1 - Summarize the steps of bacterial DNA replication,...Ch. 8.1 - Compare and contrast the synthesis of leading and...Ch. 8.1 - Prob. 1NPCh. 8.2 - Provide an overview of the relationship among DNA,...Ch. 8.2 - Identify important structural and functional...Ch. 8.2 - Draw a picture of the process of transcription.Ch. 8.2 - List the three types of RNA directly involved in...
Ch. 8.2 - Prob. 10AYPCh. 8.2 - Identify the locations of the promoter, the start...Ch. 8.2 - Indicate how eukaryotic transcription and...Ch. 8.2 - NCLEX PREP 2. The following are all true of RNA,...Ch. 8.2 - Prob. 3NPCh. 8.3 - Define the term operon, and explain one advantage...Ch. 8.3 - Prob. 14AYPCh. 8.4 - Prob. 15AYPCh. 8.4 - Prob. 16AYPCh. 8.5 - Prob. 17AYPCh. 8.5 - Differentiate among frameshift, nonsense, silent,...Ch. 8.5 - Prob. 19AYPCh. 8.5 - Prob. 1MMCh. 8.6 - Explain the importance of restriction...Ch. 8.6 - List the steps in the polymerase chain reaction.Ch. 8.6 - Describe how you can clone a gene into a...Ch. 8.6 - Prob. 23AYPCh. 8.6 - Prob. 24AYPCh. 8.6 - Name two genetic techniques that are designed to...Ch. 8.6 - NCLEX PREF 4. A client is being treated with...Ch. 8.6 - Prob. 2MMCh. 8 - Single nucleotide polymorphisms are found in a....Ch. 8 - Using your knowledge of DNA from this chapter,...Ch. 8 - Conduct research on CRISPR and explain in...Ch. 8 - Which of the following is a characteristic of RNA?...Ch. 8 - List some advantages and disadvantages to a cell...Ch. 8 - Construct an argument for why tRNA contains a lot...Ch. 8 - Prob. 7QCh. 8 - Discuss the intersection between the metabolome...Ch. 8 - Defend this statement: All of biology is dependent...Ch. 8 - DNA is semiconservative because the ______ strand...Ch. 8 - Examine the DNA triplets here and determine the...Ch. 8 - Prob. 12QCh. 8 - Prob. 13QCh. 8 - Prob. 14QCh. 8 - Metagenomics is providing insight into the...Ch. 8 - The creation of biological molecules and cells...Ch. 8 - Prob. 17QCh. 8 - Genetically modified organisms (GMOs)especially in...Ch. 8 - Prob. 19QCh. 8 - Construct an analogy using your clothes closet to...Ch. 8 - Prob. 21QCh. 8 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- View the given linked video to see the detailed structure of the different kinds of DNA. After analyzing make a simple illustration to relate the different kinds of DNA to its function. https://www.youtube.com/watch?v=o_-6JXLYS-karrow_forwardThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Glyarrow_forwardYou have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codonsarrow_forward
- Write corresponding mRNA code and the amino acid acid sequence for the DNA segment with the following code: 5’-ACT-ACT-CTA-AGC-CCC-TAC-CCG-3’arrow_forwardComplete the complementary strand: mRNA transcription ATTCGAGGCTAAarrow_forwardUsing the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGAarrow_forward
- The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGGGATAAACTC The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is the + Jend.arrow_forwardTranscribe the following DNA nucleotide sequence and determine their respective amino acid products. GCATATGTACCATAGGCTAAGATCGATTCGUGarrow_forwardWrite down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTTarrow_forward
- Describe the movement of the open complex along the DNA.arrow_forwardDetermine the complementary DNA strand that would form. Next, write the mRNA that would form from each complementary DNA strand you created (normal and mutated). Remember that adenine in DNA matches with uracil in RNA, thymine in DNA matches with adenine in RNA, and guanine and cytosine go together. Normal DNA strand - CTG ACT CCT GAG GAG Mutated DNA strand - CTG ACT CCT GTG GAGarrow_forwardIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- Garrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134580999/9780134580999_smallCoverImage.gif)
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781947172517/9781947172517_coverImage_Textbooks.gif)
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
![Text book image](https://www.bartleby.com/isbn_cover_images/9781259398629/9781259398629_smallCoverImage.gif)
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
![Text book image](https://www.bartleby.com/isbn_cover_images/9780815344322/9780815344322_smallCoverImage.gif)
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260159363/9781260159363_smallCoverImage.gif)
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
![Text book image](https://www.bartleby.com/isbn_cover_images/9781260231700/9781260231700_smallCoverImage.gif)
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License