Microbiology with Diseases by Body System (5th Edition)
5th Edition
ISBN: 9780134477206
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 7, Problem 9MC
The Ames test ___________.
- a. uses auxotrophs and liver extract to reveal mutagens
- b. is time intensive and costly
- c. involves the isolation of a mutant by eliminating wild-type
phenotypes with specific media - d. proves that suspected chemicals are carcinogenic
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Currently, a few heritable human diseases ________ treated with some success by introducing a normal copy the gene into the patient’s cells.
a.
have NOT been
b.
have been
A cell in this stage of cancer no longer makes the set of proteins that is was originally instructed to make but has not migrated into surrounding tissues; thus at this stage a tissue specific protein production profile could be used to identify a cancer.
a. carcinoma, in situ
b. dysplasia
c. hyperplasia
d. malignant tumor
Transfer RNA ____________________.
a. Carries amino acids to the ribosome
b. Carries information from the DNA to the ribosome
c. Helps make up the ribosome
d. Carries oxygen to cells
Chapter 7 Solutions
Microbiology with Diseases by Body System (5th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - Vibrio vulnificus Infection Greg enjoyed Floridas...Ch. 7 - Prob. 2TMWCh. 7 - Prob. 3TMWCh. 7 - Why is the genetic ancestry of microbes much more...Ch. 7 - Prob. 1CCSCh. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - A plasmid is ___________. a. a molecule of RNA...Ch. 7 - Prob. 4MC
Ch. 7 - Prob. 5MCCh. 7 - Which of the following molecules functions as a...Ch. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - The Ames test ___________. a. uses auxotrophs and...Ch. 7 - Which of the following methods of DNA repair...Ch. 7 - Prob. 11MCCh. 7 - Prob. 12MCCh. 7 - Which of the following statements is true? a....Ch. 7 - Prob. 14MCCh. 7 - Although two cells are totally unrelated, one cell...Ch. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Before mutations can affect a population...Ch. 7 - Prob. 25MCCh. 7 - Fill in the Blanks 1. The three steps in RNA...Ch. 7 - Fill in the Blanks 2. A triplet of mRNA...Ch. 7 - Fill in the Blanks 3. Three effects of point...Ch. 7 - Fill in the Blanks 4. Insertions and deletions in...Ch. 7 - Fill in the Blanks 5. An operon consists of...Ch. 7 - Prob. 6FIBCh. 7 - Prob. 7FIBCh. 7 - Fill in the Blanks 8. A gene for antibiotic...Ch. 7 - Fill in the Blanks 9. ______ are nucleotide...Ch. 7 - Fill in the Blanks 10. ____________ is a...Ch. 7 - Fill in the Blanks 11.________ RNA carries amino...Ch. 7 - Fill in the Blanks 12. ______ RNA and ______ RNA...Ch. 7 - How does the genotype of a bacterium determine its...Ch. 7 - List several ways in which eukaryotic messenger...Ch. 7 - Compare and contrast intrans and exons.Ch. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Describe the operon model of gene regulation.Ch. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Describe the formation and function of mRNA, rRNA,...Ch. 7 - Prob. 9SACh. 7 - Explain the central dogma of genetics.Ch. 7 - Compare and contrast the processes of...Ch. 7 - Fill in the following table:Ch. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - The drugs ddC and AZT are used to treat AIDS....Ch. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Explain why an insertion of three nucleotides is...Ch. 7 - How could scientists use siRNA to turn off a...Ch. 7 - Prob. 5CTCh. 7 - Prob. 6CTCh. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Corynebacterium diphtheriae, the causative agent...Ch. 7 - Prob. 10CTCh. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Hydrogen bonds between complementary nucleotides...Ch. 7 - On average, RNA polymerase makes one error for...Ch. 7 - We have seen that wobble makes the genetic code...Ch. 7 - If a scientist synthesizes a DNA molecule with the...Ch. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Suppose you want to insert into your dog a gene...Ch. 7 - Using the following terms, fill in the following...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The Ames Test... a. is always used to detect cancer-causing virus b. has the potential to completely replace the need of animal testing of potential carcinogens c. uses a virus constructed to be susceptible to mutagenesis caused by mutagens d. includes liver extract in the assay to determine the mutagenicity of the metabolites of test samples e. is positive for all human carcinogensarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward_________2. Which is not an application of recombinant DNA technology in medicine? a. Growth Hormone b. Insulin c. golden rich d. Blood clotting factor VIIIarrow_forward
- The results of the treatment of 20 boys with SCID-X1 showed that ____. a. the “treatment” caused numerous unforeseen complications. b. a bone marrow transplant can cure SCID-X1 c. SCID-X1 can be cured through genetic engineering d. none of those treated were cured of the disease e. our understanding of the human genome exceeds our ability to modify itarrow_forwardMutations within this gene CAGATTGTGAAGAGGTCTCTTGA are causative of which human diseases? A. mucopolysaccharidosis type II B. Turcot syndrome C. Haemophilia A D. Xeroderma pigmentosum E. Haemophilia B F. Ataxia Telangiectasia G. Noonan syndrome H. Li-fraumeni syndrome I. Hunter syndrome J. Ocular motor apraxiaarrow_forwardthose questions are answered basis of the picture A. Draw a map of the F+strain, indicating the positions of all genes and their distances apart in minutes. B. Show the insertion point and orientation of the F plasmid in each Hfr strain on the map you have drawn for part A. C. In the use of each of these Hfr strains, state which gene would you select to obtain the highest proportion of Hfr exconjugants?arrow_forward
- Question is attachedarrow_forwardQuestion 1. Describe and explain the epidemiological evidence supporting the view that cancer develops through a multi-step process involving increasingly severe stages.. Question 2. Describe and explain the genetic evidence supporting the view that cancer develops through a multi-step process involving increasingly severe stages.arrow_forwardQuestion is attachedarrow_forward
- Choose the option that correctly matches the given columns. Column I Column II a. ADA deficiency b. PCR C. Active Insulin d. Cyanogen bromide I. II. Sulphonation Deoxyadenosine Point mutations B-galactosidase A. L-(a); II. -(c); III. - (d); IV. - (b) B. I.- (b); II. - (c); III. - (a); IV. - (d) C. L.-(c); II. - (a); III. - (b); IV. - (d) D. I.-(d); II.- (c); III. - (b); IV. - (a) III. IV.arrow_forwardQuestion 9 Cancer can be described as v [ Select ] disease which results from a genetic [ Select ] an infectious Select ] cellsarrow_forwardAmong those not known to have cancers previously, nearly 450 cases are diagnosed in the U.S. per 100,000 person-years. This statement describes the ____________________ of cancer in the U.S. a. Lifetime prevalence b. Incidence proportion c. Incidence rate aka incidence density d. Period prevalencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License