Concept explainers
Interpretation:
The two recent allosteric drugs that are currently in the market and their action.
Concept introduction:
Allosteric drugs employ the concepts of allosteric modulation. Allosteric modulation refers to the regulation of the activity of an enzyme when the effector molecule binds to the enzyme at a site other than the enzyme's active site. The effector molecule can be activator or inhibitor, which can increase the activity of an enzyme or can decrease the activity of the enzyme. Allosteric drugs use allosteric modulation.
The target molecule is the hormone or neurotransmitter and it binds to the receptor for initiating or inhibiting a
Trending nowThis is a popular solution!
Chapter 7 Solutions
Biochemistry
- BIOCHEMICAL CONNECTIONS You have been hired by a pharmaceutical company to work on development of drugs to treat AIDS. What information from this chapter will be useful to you?arrow_forwardBIOCHEMICAL CONNECTIONS Beriberi is a disease caused by a deficiency of vitamin B1 (thiamine) in the diet. Thiamine is the precursor of thiamine pyrophosphate. In view of what you have learned in this chapter, why is it not surprising that alcoholics tend to develop this disease?arrow_forwardBIOCHEMICAL CONNECTIONS Cancer cells grow so rapidly that they have a higher rate of anaerobic metabolism than most body tissues, especially at the center of a tumor. Can you use drugs that poison the enzymes of anaerobic metabolism in the treatment of cancer? Why, or why not?arrow_forward
- REFLECT AND APPLY Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG3' Reverse primer 5'TTCTAAGAAACTGTTAAGG3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC3' Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG3' Reverse primer 5'CGGACCTTCATTGGCAATTCGA3'arrow_forwardREFLECT AND APPLY A mutation that changes an alanine residue in a protein to an isoleucine leads to a loss of activity. Activity is regained when a further mutation at the same site changes the isoleucine to a glycine. Why?arrow_forward
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning