Concept explainers
To determine: The results of Altman and colleagues experiments to indicate that RNase P is a ribozyme.
Introduction: RNase P acts as a catalyst during the processing of transfer RNA (Ribose
To determine: The effect of Mg2+ (magnesium ions) concentration on the function of RNA (Ribose nucleic acid) subunit in RNase P.
Introduction: RNase P acts as a catalyst during the processing of transfer RNA (Ribose nucleic acid) molecules. RNase P contains two subunits- one is a RNA molecule that possesses 377 nucleotides and other is a small protein molecule having a mass of 14 kilo Dalton. Altman and his colleagues purified this RNase P molecule and studied their important properties.
Want to see the full answer?
Check out a sample textbook solutionChapter 6 Solutions
Biology
- In the "biochemical assay of b-galactosidase activity", what is o-nitrophenyl-b-D-galactosidase (ONPG) used for? O When ONPG is cleaved by b-galactosidase, we are able to assay b-galactosidase activity. O It provides essential nutrients for bacterial growth. It partially disrupts the cell membrane to allow cellular proteins to diffuse out of the cell. O ONPG cleaves the b-galactosidase that is made by the lac operon so we can see how much activity there is in the cell. ONPG cleaves galactose so we can measure how much lactose there is in the cell.arrow_forwardMAKE CONNECTIONS Mutagens are chemical andphysical agents that induce mutations in DNA (seeConcept 17.5). How does reduced ozone concentrationin the atmosphere increase the likelihood of mutationsin various organisms?arrow_forwardYou were recently tasked with the responsibility of generating an aptamer that was capable of binding to protein K with high specificity. a) Describe how you would utilize methods such as SELEX to identify aptamer candidates with the desired property. b) Assuming that aptamer binding was dependent on the presence of a bound Mg2+ (no metal binding site on protein K) describe how you would account for this metal binding requirement in your SELEX workflow.arrow_forward
- © Macmillan Learning Predict the amino acid sequences of peptides formed by ribosomes in response to each mRNA sequence, assuming that the reading frame begins with the first three bases in each sequence. Construct the peptides using the one-letter codes of the amino acids. GQSLI GGUCAGUCGCUCCUGAUU: Incorrect Answer UUGGAUGCGCCAUAAUUUGCU: LDAP Correct Answer < Feedback O Macmillan Learning Sorry, that's incorrect. You have not correctly entered the Х peptide sequence corresponding to the first mRNA sequence. The codons within the first mRNA sequence are: GGU, CAG, UCG, CUC, CUG, and AUU. Find each codon within the amino acid codon table and identify its corresponding amino acid. HDRCA CAUGAUGCCUGUUGCUAC: Incorrect Answer MDE AUGGACGAA: Correct Answerarrow_forwardThe previously accepted model of the chloramphenicol action was that it inhibited all ribosomes equally. Why were the authors of the Marks, 2016 paper skeptical of this model? Choose all that are correct. Because they had observed that certain bacteria were resistant to chloramphenicol, and this proves that chloramphenicol stalls ribosomes at certain sites within those bacteria. Because certain MRNA templates had been observed to be inhibited by chloramphenicol more strongly than others Because chloramphenicol induces expression of chloramphenicol resistance proteins through translational arrest at specific codons in the leader ORFS of chloramphenicol resistance genes, which suggests there is preferential stalling at certain sites. Because chloramphenicol induces expression of chloramphenicol resistance proteins - therefore, these proteins must be able to be translated during chloramphenicol treatment. Because chloramphenicol binds the decoding center of the 30S subunit, and there are…arrow_forwardNeed help herearrow_forward
- The phylogenetic tree of the OCTN homologs below was generated with the following accession numbers as the basis: NP_957143.1 - OCTN of unknown function CDM63451.1 - OCTN specific for ergothioneine transport XP_021324939.1 - OCTN specific for carnitine transport Which of the Salmo salar homologs has the most probable function as an ergothioneine transporter? Why?arrow_forwardThe phylogenetic tree of the OCTN homologs below was generated with the following accession numbers as the basis: NP_957143.1 - OCTN of unknown function CDM63451.1 - OCTN specific for ergothioneine transport XP_021324939.1 - OCTN specific for carnitine transport Which of the Salmo salar homologs has the most probable function as an ergothioneine transporter? Why?arrow_forwardThe phylogenetic tree of the OCTN homologs below was generated with the following accession numbers as the basis: NP_957143.1 - OCTN of unknown function CDM63451.1 - OCTN specific for ergothioneine transport XP_021324939.1 - OCTN specific for carnitine transport Which of the Salmo salar homologs has the most probable function as an ergothioneine transporter? Why? asap pleasearrow_forward
- Which of the following statements regarding Anfinsen's denaturing experiments with ribonuclease A are valid? (i) Exposing the denatured protein to air oxidation and then dialysis to remove urea restored the protein to its original functionality. (ii) Removing urea by dialysis and then allowing air oxidation of the denatured protein restored the protein to its original functionality. (iii) Denaturing the protein with both urea and β-mercaptoethanol yielded an inactive protein. (iv) Protein folding is determined by its primary sequence.arrow_forward(3) What is a protein database? Give examples (and links) of some protein databasearrow_forwardHow do the researchers demonstrate that only diseased blood vessel (affected by atherosclerosis) is targeted by the polyelectrolyte complex micelles?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning