Concept explainers
Interpretation:
The alignment that has a higher score according to identity-based alignment scoring.
Concept introduction:
Identity−based alignment scoring is a method to score the identical alignments present in a sequence. The identical amino acids are added while the gaps in the sequence are subtracted to determine the identical score.
(b)
Interpretation:
The alignment that has a higher score according to the Blosum -62 substitution method.
Concept introduction:
Blosum-62 is a type of substitution matrix that is used to score the replacement of amino acids. A positive score of substitution matrix indicates that substitution of amino acid occurs more frequently while a negative score is rare for substitutions.
Trending nowThis is a popular solution!
- Compute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGTarrow_forwardCalculate the dynamic programming matrix and the optimal local and global alignment for the DNA sequences a: GAATTC and b: GATTA, scoring +2 for a match, -1 for a mismatch, and using a linear gap penalty function WL) = -2L thank youarrow_forwardFor the following sequence please design an 18 base pair forward primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forward
- Based on base substitution rates, which of the following is likely to be true? P(A/G) = P(A/T) O P(A/G) ≥ P(A/T) P(A/G) = P(A/T) P(A/G) ≤ P(A/T)arrow_forwardRice genome contains 30% C on a molar basis. What are the mole percentages of A, G, and T?arrow_forwardBelow are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…arrow_forward
- Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'arrow_forwardUsing the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) Barrow_forwardEach of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'arrow_forward
- For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'arrow_forwardHidden Markov Model (HMM) Construct the HMM for the following sequences 2) G C A A A A G A A T G C A A G A The matches are considered for the columns [1, 2,4,5, and 7]arrow_forwardA lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possiblearrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning