Microbiology: An Introduction
12th Edition
ISBN: 9780321929150
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 6, Problem 2R
Summary Introduction
To review:
About the macronutrients and its uses in the cell functions.
Introduction:
Microbes present in different environments require nutrients for their growth and
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Whenever a person consumes dairy products, they utilize lactase enzymes to break down the disaccharide carbohydrate, lactose into monosaccharides: galactose and glucose. Overtime, these enzymes become worn and need to be replaced. The following DNA sequence contains the information needed to build more lactase enzymes:
3’ – ACCTCTTACTTTTATATATAGGGAAGACTAATTGTC – 5’
5’ – TGGAGAATGAAAATATATATCCCTTCTGATTAACAG– 3’
Which strand is the template strand?
What is the most significant difference between glycan synthesis and other biopolymer syntheses, such as DNA, RNA, and protein?
what does it mean to be lactose intolerant?
Chapter 6 Solutions
Microbiology: An Introduction
Ch. 6 - Prob. 1RCh. 6 - Prob. 2RCh. 6 - Prob. 3RCh. 6 - Seven methods of measuring microbial growth were...Ch. 6 - By deep-freezing, bacteria can be stored without...Ch. 6 - A pastry chef accidentally inoculated a cream pie...Ch. 6 - Nitrogen and phosphorus added to beaches following...Ch. 6 - Differentiate complex and chemically defined...Ch. 6 - DRAW IT Draw the following growth curves for E....Ch. 6 - NAME IT A prokaryotic cell hitched a ride to Earth...
Ch. 6 - Two culture media were inoculated with four...Ch. 6 - Two culture media were inoculated with four...Ch. 6 - Use the following graph to answer questions 3 and...Ch. 6 - Use the following graph to answer questions 3 and...Ch. 6 - Assume you inoculated 100 facultatively anaerobic...Ch. 6 - The term trace elements refers to a. the elements...Ch. 6 - Which one of the following temperatures would most...Ch. 6 - Which of the following is not a characteristic of...Ch. 6 - Which of the following types of media would not be...Ch. 6 - An organism that has peroxidase and superoxide...Ch. 6 - E. coli was incubated with aeration in a nutrient...Ch. 6 - Clostridium and Streptococcus are both...Ch. 6 - Most laboratory media contain a fermentable...Ch. 6 - Flask A contains yeast cells in glucose-minimal...Ch. 6 - Clinical Applications and Evaluation 1. Assume...Ch. 6 - Heat lamps are commonly used to maintain foods at...Ch. 6 - The number of bacteria in saliva samples was...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Does concentration of xylulose-5-phosphate increase in cells after eating rice? Explainarrow_forwardWhat is the role of dictyosomes in cell metabolism? What is their forming face? Their maturing face? With referencesarrow_forwardWhy is it advantageous for the E.coli to stop production of lactose digesting enzymes when lactose is absent?arrow_forward
- Describe which enzymes are required for lactose and tryptophan metabolism in bacteria when lactose and tryptophan, respectively, are (a) present and (b) absent.arrow_forwardWhat role do glycocalyces play in the ability of bacteria to survive and cause disease? ( this answer should have at least 6 functions of a glycocalyx. Each function should describe the mechanism that allows the glycocalyx to help the bacteria survive and/or cause disease.)arrow_forwardCan you please draw the mechanism of phosphorylation (all intermidiate steps) and indicate which one is the major product? Thank you, I would rate your answer:)arrow_forward
- create a single illustration that will interrelate or link the two opposing pathways, the Glycogenesis and Glycogenolysis. I want you to include the enzyme in each step and include some important by-products as well. From the illustration, I want you to encircle the intermediate molecule to highlight the link between the two processes. Aside from the illustration, I want you to compare and contrast the two pathways in terms of function, number of reaction steps, and usage of UTP. You can tabulate this part to make it simpler.arrow_forwardHow is synthesis and degradation of fructose-2,6-bisphosphate achieved?arrow_forwardAlthough rabbits cannot digest the cellulose in their all-plant diet, bacteria that live in their cecum can. However, to make full use of the nutrients released by bacterial action, a rabbit must produce and eat a special type of feces. Why must the rabbit reswallow this material to obtain the nutrients released by bacterial action?Some people who have gallstones experience pain after they eat, with fatty meals causing the greatest discomfort. Why do such meals trigger gallbladder pain? Diabetes insipidus is a medical disorder in which a person produces an unusually large amount of highly dilute urine. Some cases are caused by a gene mutation, but in most people, diabetes insipidus arises after a head injury. Explain how an injury to the head could affect kidney function.Marine mammals and desert rodents both have highly efficient kidneys that produce only a tiny amount of very concentrated urine. What selective pressure shaped this trait in both animals?arrow_forward
- Provide an illustration showing the broken down of C7 fatty acid into its corresponding end products. What are the products being generated and how much of these products are generated from C7 fatty acids? Briefly explain it.arrow_forwardA glycogen polymer and an amylopectin polymer, each containing 100 monosaccharide subunits, are cleaved completely by an enzyme. How many individual glucose molecules are created during this process?arrow_forwardGive the illustration showing the broken down of C7 fatty acid into its corresponding end products. What are the products being generated and how much of these products are generated from C7 fatty acids?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education