Microbiology: Principles and Explorations
9th Edition
ISBN: 9781118743164
Author: Jacquelyn G. Black, Laura J. Black
Publisher: WILEY
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 6, Problem 12SQ
Which of the following statements about endospores is true?
- (a) Endospore formation in some bacteria occurs because of environmental stressors such as a limiting nutrient or extremes in pH.
- (b) Endospore formation in bacteria is a means of reproduction.
- (c) Endospore formation occurs in Bacillus, Clostridium, and a few other Gram-positive genera.
- (d) When favorable conditions are restored, endospores undergo germination or development into a vegetative cell.
- (e) a, c, and d.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
Chapter 6 Solutions
Microbiology: Principles and Explorations
Ch. 6 - What are the differences between the lag phase and...Ch. 6 - How does logarithmic rate of increase differ from...Ch. 6 - Prob. 1.3SCCh. 6 - Why does a direct microscopic count of bacteria...Ch. 6 - What does the ending -phile mean? Distinguish...Ch. 6 - What enzymes do most obligate anaerobes lack? How...Ch. 6 - Prob. 2.3SCCh. 6 - Prob. 3.1SCCh. 6 - Distinguish between the various kinds of media:...Ch. 6 - What is the purpose of a stock culture? Why is it...
Ch. 6 - Prob. 1CCSCh. 6 - Exactly 100 bacteria with a generation time of 30...Ch. 6 - In the above example, do you think that the number...Ch. 6 - Prob. 3CTQCh. 6 - Prob. 1SQCh. 6 - Match the following growth phase terms to their...Ch. 6 - Which of the following is the best definition of...Ch. 6 - Prob. 4SQCh. 6 - The most probable number (MPN) technique is a...Ch. 6 - Match the terms with their definitions:Ch. 6 - Prob. 7SQCh. 6 - Why do foods containing a high concentration of...Ch. 6 - Some bacteria have complex nutritional...Ch. 6 - Prob. 10SQCh. 6 - Which type of cell will shift to aerobic...Ch. 6 - Which of the following statements about endospores...Ch. 6 - Prob. 13SQCh. 6 - Blood agar is often used to observe changes in the...Ch. 6 - A bacterial medium that contains 20 grams of beef...Ch. 6 - MacConkey agar contains the dye, crystal violet,...Ch. 6 - Prob. 17SQCh. 6 - What are the purposes of carrying out the streak...Ch. 6 - Prob. 19SQCh. 6 - During quorum sensing, bacteria sense their...Ch. 6 - Prob. 21SQCh. 6 - Identify the position of each of the following on...
Additional Science Textbook Solutions
Find more solutions based on key concepts
3. What is free-fall, and why does it make you weightless? Briefly describe why astronauts are weightless in th...
The Cosmic Perspective (8th Edition)
What is the difference between interstitial and appositional growth of cartilage?
Principles of Anatomy and Physiology
2. What are the primary functions of the skeletal system?
Human Anatomy & Physiology (2nd Edition)
Why are BSL-4 suits pressurized? Why not just wear tough regular suits?
Microbiology with Diseases by Body System (5th Edition)
4. 38 Strontium has four naturally occurring isotopes, with mass numbers 84, 86, 87, arid 88.
a. Write the atom...
General, Organic, and Biological Chemistry: Structures of Life (5th Edition)
Choose the best answer to each of the following. Explain your reasoning. When we see Saturn going through a per...
Cosmic Perspective Fundamentals
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBasic Clinical Lab Competencies for Respiratory C...NursingISBN:9781285244662Author:WhitePublisher:Cengage
Principles Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Basic Clinical Lab Competencies for Respiratory C...
Nursing
ISBN:9781285244662
Author:White
Publisher:Cengage
Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Prokaryotic vs. Eukaryotic Cells (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=Pxujitlv8wc;License: Standard youtube license