Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 5, Problem 7P
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.
Solving the Sequence of an Oligopeptide From Sequence AnalysisData An octapcptide consisting of 2 Gly, 1 Lys, 1 Met, I Pro, I Arg,
1 Trp, and 1 Tyr was subjected to sequence studies. The following was found:
- Edman degradation yielded
- Upon treatment with carboxypeptidases A. B, and Y, only carboxypeptidase Y had any effect.
- Trypsin treatment gave two tripeptides and a dipeptide.
- Chymotrypsin treatment gave two tripeplides and a dipeptide. Acid hydrolysis of the dipeptide yielded only Gly.
- Cyanogen bromide treatment yielded two tetrapeptides.
- Closlripain treatment gave a pentapeptide and a tripeptide. What is the amino acid sequence of this octapeptide?
Expert Solution & Answer
Trending nowThis is a popular solution!
Chapter 5 Solutions
Biochemistry
Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...Ch. 5 - Answers to all problems are at the end of this...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Historical Context) The Third Person of the -Helix Publication Who was Herman Branson? What was his role in the elucidation of the structure of the or-helix'.' Did he receive sufficient credit and recognition for his contributions? And how did the rest of his career unfold? Do a Google search on Herman Branson to learn about his life, and read the article by David Eisenberg under Further Reading. You may also wish to examine the original paper by Pauling, Corey, and Branson, as well as the following Web site: http://www.pirns. org/sitelmisclclassicsl..shtml Pauling, L., Corey, R. B., and Branson, H. R., 1951. The structure of proteins: two hydrogen-bonded helical configurations of the polypeptide chain. Proceedings of the National Academy of Sciences, USA 37:235-240.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Helical Parameters I A 41.5-nm-long duplex DNA molecule in the B conformation adopts the A-conformation upon dehydration. How long is it now? What is its approximate number of base pairs?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B-and Z-DNA Helical Parameters II If 80% of the base pairs in a duplex DNA molecule (12.5 kbp) are in the B-conformation and 20% are in the Z-conformation, what is the length of the molecule?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Research Problem) The Nature and Roles of Linear Motifs in Proteins In addition to domains and modules, there are other significant sequence patterns in proteins—known as linear motifs—that are associated with a particular function. Consult the biochemical literature to answer the following questions: 1. What are linear motifs? 2. How are they different from domains?. 3. What are their functions? 4. How can they be characterized? 5. There are several papers that are good starting points for this problem. Neduva, V., and Russell, R., 2005. Linear motifs: evolutionary interaction switches. FEBS Letters 579:3342-3345. Gibson, T., 2009. Cell regulation: determined to signal discrete cooperation. Trends in Biochemical Sciences 34:471-482. Diella, K. Haslam, N., Chica., C. et aL, 2009. Understanding eukaryotic linear motifs and their role in cell signaling and regulation. Frontiers of Bioscience 13:6580-6603.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Base Sequence in the Two Polynucleotide Chairs of a DNA Double Helix Is Complementary Adhering to the convention of writing nucleotide sequences in the 5' 3' direction, what is the nucleotide sequence of the DNA strand that is complementary to d-ATCGCAACTGTCACTA?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. The Sequence Relationship Between an Antisense RNA Strand and Its Template DNA Strand The DNA strand that is complementary to the template strand copied by RNA polymerase during transcription has a nucleotide sequence identical to that of the RNA being synthesized (except T residues are found in the DNA strand at sites where U residues occur in the RNA). An RNA transcribed from this nontem-plate DNA strand would be complementary to the mRNA synthesized by RNA polymerase. Such an RNA is called antisense RNA because its base sequence is complementary to the “sense mRNA. One strategy to thwart the deleterious effects of genes activated in disease slates (such as cancer) is to generate antisense RNAs in affected cells. These antisense RNAs would form double-stranded hybrids with mRNAs transcribed from the activated genes and prevent their translation into protein. Suppose transcription of a cancer-activated gene yielded an mRNA whose sequence included the segment 5’-UACGUCUAAGCUGA. What is the corresponding nucleotide sequence (5’ The template strand in a DNA duplex that might be introduced into these cells so that an untisense RNA could be transcribed from it?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Solving the Sequence of an Oligopeptide From Sequence Analysis Data Amino acid analysis of a decapeptide revealed the presence of the following products: The following facts were observed: Neither car boxy peptidase A nor B treatment of the- decapeptide had any effect. Trypsin treatment yielded two tetrapcptides and free Lys. Clostripain treatment yielded a tetrapcptide and a hexapeptidc. Cyanogen bromide treatment yielded an octapeptide and a dipeptide of sequence NP (using the one-letter codes). Chymotrypsin treatment yielded two tripeptides and a telrapeptide. The N-terminal chymotryptic peptide had a net charge of — 1 at neutral pi I and a net charge of —3 al pH 12. One cycle of Ed man degradation gave the PTH derivative What is the ammo acid sequence of this decapeptide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identify Proteins Using BLAST Searches of Peptide Fragment Sequences Go to the National Center for Biotechnology Information Web site at httlp:llhwww.ncbi.nlm.niih.goyl. From the menu (if Popular Resources on the right-hand side, click on “BLAST. Under the Basic BLAST heading on the new page that comes up, dick on protein blast. lit the Enter Query Sequence box at the top of the page that comes up, enter the following sequence: NQMMK.SR.N- LTKDRCKP. Confirm that the database under ChoOsC Search Set us set (111 nr (nonredundant protein Sequences), then click the BLAST button at the bottom (if the page td see the results of your search. Next, enter this sequence from a different protein: SLQTASAPDVYAlGfcCA. Identify the protein from which this sequence was derived.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Chapter 7 - Human Movement Science; Author: Dr. Jeff Williams;https://www.youtube.com/watch?v=LlqElkn4PA4;License: Standard youtube license