To determine: The way by which ricin led to the death of Markov.
Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.
Explanation of Solution
Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.
Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of
Want to see more full solutions like this?
Chapter 38 Solutions
BIO 1406/07 BK/LAB/CODE PREPACK
- Question one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -arrow_forwardQuestions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yields an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.arrow_forwardEffects of BPA on phosphorylation of cPLA2 in RAW264.7 cells conclusionarrow_forward
- Question 2 pleasearrow_forwardQuestion:- Part A) How does the molecular mechanism of elongation arrest by SRP differ between Bacillus and Mammalian systems? Please list all the differences and why. Thank you and please explain. Part B) List four interactions of the Ffh M domain in SRP mechanism.arrow_forwardNeed helparrow_forward
- "Use of Dexamethasone in the context of COVID 19" Please briefly explain this statement at your own easy words. Your answer should include figures or images. Please don't use AI for answering this question.arrow_forwardThe PCB Dilemma of the Hudson River D9 No unread replies.No replies. Winding through upstate New York, the Hudson River Valley comprises some of the most beautiful country in the Northeast. But serious problems lurk below the glimmering surfaces of the Hudson’s blue water. From 1947 to 1977, the General Electric Company released over 1.2 million pounds of toxic chemicals called polychlorinated biphenyls (PCBs) into the river from facilities in Hudson Falls and Fort Edward, New York. PCBs were commonly used in transformer boxes, capacitors, and cooling and insulating fluids of electrical equipment manufactured before 1977. PCBs are no longer used in manufacturing in the United States, and they have been banned in most of the world. PCBs are very toxic to humans and wildlife because these fat-soluble chemicals gradually accumulate in fatty tissues. Hudson River fish are contaminated with PCBs at concentrations in excess of safe levels. Consumption of fish from most areas of the…arrow_forwardQuestion:- What are SNARES and where are they found? Briefly describe the role they play in protein targeting.arrow_forward
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning