To determine: The way by which ricin led to the death of Markov.
Introduction: Ricin is a highly toxic protein that is produced from Ricinus communis. The toxicity of ricin is not only twice to the cyanide, but also has the lethal effects much higher than the venom of a cobra. The compound is found to be present in the endosperm of the seed.
Explanation of Solution
Ricin is the combination of two compounds, ricin A and ricin B, in which ricin A is less toxic and found in the form of proricin. However, ricin B possesses the toxicity when disulfide bonds are hydrolyzed after the consumption of animals. The target site of ricin is the ribosome, which results in the inhibition of translation to form proteins.
Georgi Markov was a Bulgarian expatriate, who liked to do work as a novelist. On his way to London, a pinhead-sized metal from an umbrella pierced into the thigh of a person with intense pain. The metal contained approximately 0.2 mg of ricin compound, which injected into the skin of the person and caused the death of a person. The reason is that ricin led to stop the translation of protein and shutting down of
Want to see more full solutions like this?
Chapter 38 Solutions
BIOLOGY (LOOSELEAF)-W/CONNECT
- Question:- 1. Describe an assay that could measure the activity of adenylyl cyclase (AC).arrow_forwardQuestion one parts A though E a. True / False: Guanine to cytosine intermolecular interactions (hydrogen bonding) is stronger than adenine to thymine. b. What peptide would be made from the following DNA sequence? 5'ATCCCGGGTACTCACTCCCAT3' Start-Gly-Pro-Stop Start-Gly-Ser-Pro-Val-Arg-Val Start-Gly-Gly-Thr-lle-Arg Start-Arg-Arg-Gly-Gly c. Starting from the MRNA strand below - what peptide would be produced? Remember your start and stop codons...5'CCAUGCGGCAUACCAAAUUACUAAACUAGC3' Start-Arg-His-Thr-Lys-Leu-Leu-Asn-Stop Start-Asn-Leu-Leu-Lys-Thr-His-Arg-Stop Start-Arg-Lys-Leu-Asn-Stop Pro-Met-Arg-His-Leu-Leu-Asn d. Which type of RNA comprises over 80% of total cellular RNA? ribosomal RNA Messenger RNA Transfer RNA e. True / False - All of the DNA nucleotides are attached to the deoxyribose in the BETA configuration (at the anomeric carbon of the sugar). B (Ctrl) -arrow_forwardQuestion: Summarize The Theory Of SDS-PAGE Electrophoresis.arrow_forward
- Questions and situational problems I. A particular gene codes for a mature mRNA containing 900 bases, which is translated into a 40 kDa protein. A mutant form of the gene created by a single point mutation yields an 830-base mature mRNA yielding a 37 kDa protein with modified enzymatic activity. The analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.arrow_forwardquestion: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Interference with Cellular Uptake, Immobilization, and Inactivation of the Virus Outside of the Host Cell Nanomaterials can be synthesized with a high specific surface area of a few hundred square meters per gram. Therefore, dependent on the surface properties, nanomaterials efficiently adsorb biomolecules and form a so-called biomolecular corona. This passive, nontargeted adsorption might be utilized to bind viruses, provided that the selected nanomaterial is relatively biocompatible. Viral surface proteins are often modified by sugar moieties or encompass positively charged amino acid patches that bind to lectins or glycosaminoglycans (GAGs) of heparan sulfate…arrow_forwardQuestion Help ▼ Medication is often delivered through an intravenous (IV) drip line that allows a prescribed amount of a drug to be administered at a fixed rate. Each delivery system has a particular drop factor, which is the number of drops per milliliter of solution (gtt/mL). Complete parts (a) through (c) below. A Click the icon to view common metric prefixes. a. A particular macrodrip system has a drop factor of 17 gtt/mL. How many drops are in a 0.5-L bag of normal saline? There are 8500 drops in a 0.5-L bag of normal saline. (Simplify your answer. Type an integer or a decimal.) b. A particular microdrip system has a drop factor of 52 gtt/mL. How many drops are in a 1-L bag of D5W (dextrose) solution? There are 52000 drops in a 1-L bag of dextrose solution. (Simplify your answer. Type an integer or a decimal.) c. Suppose an entire 1-L bag of normal saline is administered in 3 hours through a system with a drop factor of 9 gtt/mL. How many drops were delivered? drops were…arrow_forward
- PDB code 7BSJ Questions Q1 - What is the name of the protein Q2 - What does the protein do? Q3 - What are the structural features of the protein? Q4 - What are two features of your protein’s structure that make it different OR similar to haemoglobin? Q5 - Based on the structural properties of your protein, how resistant (or sensitive) would your protein be to heat denaturation and why?arrow_forwardEffects of BPA on phosphorylation of cPLA2 in RAW264.7 cells conclusionarrow_forwardBIOMOLECULES - MULTIPLE CHOICE - Please answer properly QUESTION : Major controls of de novo AMP synthesis include: 1. allosteric inhibition by GMP allosteric inhibition by AMP 3. availability of PRPP 4. stimulation by GTP A. 1, 2, 3, and 4 B. 1, 2, and 3 C. 2 and 4 D. 1 and 3arrow_forward
- The PCB Dilemma of the Hudson River D9 No unread replies.No replies. Winding through upstate New York, the Hudson River Valley comprises some of the most beautiful country in the Northeast. But serious problems lurk below the glimmering surfaces of the Hudson’s blue water. From 1947 to 1977, the General Electric Company released over 1.2 million pounds of toxic chemicals called polychlorinated biphenyls (PCBs) into the river from facilities in Hudson Falls and Fort Edward, New York. PCBs were commonly used in transformer boxes, capacitors, and cooling and insulating fluids of electrical equipment manufactured before 1977. PCBs are no longer used in manufacturing in the United States, and they have been banned in most of the world. PCBs are very toxic to humans and wildlife because these fat-soluble chemicals gradually accumulate in fatty tissues. Hudson River fish are contaminated with PCBs at concentrations in excess of safe levels. Consumption of fish from most areas of the…arrow_forwardQuestion:- What are SNARES and where are they found? Briefly describe the role they play in protein targeting.arrow_forwardquestion: Can you summarize and explain for me what you want to tell in the article below? When I read it myself, I do not understand exactly what is meant by the article. It would be nice if you could highlight the important points. You can use them in a figure or diagram to explain. thank you and hava a nice day :) Article: Biomimetic Engineering of Nanodelivery Systems: Artificial Viruses in the Making In an effort to engineer the next generation of nanoscale vectors, scientists have moved from using inorganic components aimed at obtaining inert structures to utilizing biological building blocks that are able to convey additional functionalities to the resulting construct. To cope with the complexity of the body and to evade the multiple layers of defense that tissues and organs have, it is critical to rely on the ability of certain materials to interact with, rather than to eschew, the biology of our body. Every NP system conceived to date faces one common fate: whether injected,…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education