Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 3.6, Problem 4RIA
Retrieve, Infer, Apply
Explain the importance of each of the following plasmids: conjugative plasmid, R plasmid, Col plasmid, virulence plasmid, and
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Explain the importance of each of the following plasmids: conjugative plasmid, R plasmid, Col plasmid, virulence plasmid, and metabolic plasmid.
Give advantages and disadvantages of using commercially available kits for plasmid extraction over conventional alkaline lysis technique.
state two ways one can extract an insert from a plasmid
Chapter 3 Solutions
Prescott's Microbiology
Ch. 3.2 - Retrieve, Infer, Apply Why is the term prokaryote...Ch. 3.2 - Retrieve, Infer, Apply What characteristic shapes...Ch. 3.2 - Retrieve, Infer, Apply What advantages might a...Ch. 3.2 - Prob. 4RIACh. 3.3 - Retrieve, Infer, Apply List the functions of...Ch. 3.3 - Retrieve, Infer, Apply Describe in words and with...Ch. 3.3 - Retrieve, Infer, Apply 3. On what basis are...Ch. 3.3 - Retrieve, Infer, Apply Describe facilitated...Ch. 3.3 - Retrieve, Infer, Apply 5. What are uniport,...Ch. 3.3 - Retrieve, Infer, Apply 6. What are siderophores?...
Ch. 3.4 - MICRO INQUIRY How does the outer membrane of the...Ch. 3.4 - MICRO INQUIRY Are these transporter proteins...Ch. 3.4 - Retrieve, Infer, Apply Describe in detail the...Ch. 3.4 - Retrieve, Infer, Apply List the major molecules...Ch. 3.4 - Retrieve, Infer, Apply When protoplasts and...Ch. 3.4 - Retrieve, Infer, Apply 4. The cell walls of most...Ch. 3.4 - Retrieve, Infer, Apply What two mechanisms allow...Ch. 3.5 - Retrieve, Infer, Apply What is the difference...Ch. 3.5 - Retrieve, Infer, Apply S-layers and some capsules...Ch. 3.6 - Retrieve, Infer, Apply Briefly describe the nature...Ch. 3.6 - Retrieve, Infer, Apply List the most common kinds...Ch. 3.6 - Retrieve, Infer, Apply do plasmids differ from...Ch. 3.6 - Retrieve, Infer, Apply Explain the importance of...Ch. 3.7 - MICRO INQUIRY How does flagellum growth compare to...Ch. 3.7 - Retrieve, Infer, Apply What are the functions of...Ch. 3.7 - Retrieve, Infer, Apply What terms are used to...Ch. 3.7 - Retrieve, Infer, Apply What is self-assembly? Why...Ch. 3.8 - Would this flagellum be found in a typical...Ch. 3.8 - Retrieve, Infer, Apply Describe the way many...Ch. 3.8 - Prob. 2RIACh. 3.8 - Prob. 3RIACh. 3.8 - Retrieve, Infer, Apply Suggest why chemotaxis is...Ch. 3.9 - Retrieve, Infer, Apply Describe the structure of...Ch. 3.9 - Retrieve, Infer, Apply Briefly describe endospore...Ch. 3.9 - Retrieve, Infer, Apply What features of the...Ch. 3 - Propose a model for the assembly of a flagellum in...Ch. 3 - The peptidoglycan of bacteria has been compared...Ch. 3 - Why might a microbe have more than one uptake...Ch. 3 - Design an experiment that illustrates the cell...Ch. 3 - What would you expect to observe if you were able...Ch. 3 - Develop a hypothesis to explain why gas vacuoles...Ch. 3 - In 2009 it was reported that a member of the genus...Ch. 3 - LPS is synthesized in the cytoplasm and then...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- draw structure of plasmidarrow_forwardConsider the DNA CAAGGAGCAAGTAGCCAAGA and briefly describe the plasmid to be used and the method for delivering into human cells.arrow_forwardAGAROSE GEL ELECTROPHORESIS PRELAB ANSWER ALL QUESTIONS 1. Type of nucleotide is one of the factors that influence electrophoretic mobility. a) True b) False 2. Electrophoresis is used for DNA separation and not proteins. a) True b) False 3. DNA Polymerase is an enzyme to cut DNA into fragments for electrophoresis. a)True b)False 4. Electrophoresis apparatus consists of Gel buffer, chamber and DNA separator. a) True b) False 5. During electrophoresis, DNA fragments collect at the Cathode. a) True b) Falsearrow_forward
- Besides heat shock method, elaborate another procedure commonly used for transformation vector a host cell. of a plasmid intoarrow_forwardBonus question: What are F plasmids? What are resistance plasmids? Include in your answer -the functions for each type of plasmid (which genes do they carry)? -an explanation of why these plasmids are major problems in the heath care.arrow_forwardWhat is a mobilizable plasmid?arrow_forward
- biotechnology lab class :1. The bacterial streaking on antibiotic containing agar plates has been completed and the plates will be available for you to inspect in the lab class.2. You will complete a restriction enzyme digest on the four available plasmid stocks and then examine the products by agarose gel electrophoresis. Photographs of the gel are attached to identify the plasmid present in each analysed sample.Now consider the following questions :- For each of the four plasmids used in the practical, identify the size (in kb) of the linear DNA fragment(s) that you would expect to obtain if the EcoRI digest is complete.- Using the provided negative image of the gel, which shows the bands present in the ND and D samples for each plasmid, identify the plasmid that was present in each of the four plasmid stock.- Explain how you were able to identify plasmid in each sample using the gel, considering how linear DNA fragments of different length are separated by agarose gel…arrow_forward(a) Why the plasmid (containing the foreign DNA), together with the competentbacterial cells are heated at 42°C? b) What would be the next stage after heat shock? Discuss the process involved.c) How would you analyze the efficiency of the competent cells used duringtransformation?arrow_forwardWhat is the purpose of ampicillin in the pGLO lab, where is the ampicillin locates, how it can be described as selective, and how does it relate to the plasmid used?arrow_forward
- You first need to create a plasmid. What are the minimal components necessary to develop this plasmid? In addition to these components, please draw the plasmid. In this illustration, I am looking for the components, the direction of transcription (i.e., the direction the genes will be transcribed), and what should be transcribed last? Also, where would you specifically insert the P. falciparum gene in this plasmid, and why are you checking reading frames in your gene? Finally, please name your plasmid using the correct nomenclature too. You are excited you have this new plasmid; you want to transfect it into P. marinus and provide it as an oral vaccine to laboratory mice. However, even though your supervisor enjoys your enthusiastic attitude, they do not allow you to do this quite yet because all you have is this plasmid. Why doesn’t your supervisor allow you to use the laboratory mouse for this research regarding animal welfare guidelines? Your answer should include the 3 R’s of…arrow_forwardDefine mobilizable plasmid?arrow_forwardExplain the features of commercially prepared plasmids ?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY