Concept explainers
Interpretation: The sequence of the DNA coding strand and DNA template strand for the following mRNA sequence should be determined:
5’-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3’
Concept introduction:
DNA stores genetic information in a stable form that can be readily replicated.
The template strand is DNA strand from which mRNA is built and it serves as a template for transcription. It runs in a 3’ to 5’ direction.
The DNA strand which is not used as template for transcription is said to be a coding strand as it corresponds to the same sequence as that of mRNA, the only difference is instead of thymine, uracil is present in mRNA strand.
Answer to Problem 1P
For the given RNA sequence, the sequence of the coding strand is 5’-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3’ and the sequence for the template strand is 3’-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5’.
Explanation of Solution
If the left chain is the coding chain, one reads from the 5’ end above downwards. So, the code is read as ‘…ATTGC…’ in this small part of the gene.
The template strand and the coding strand are complementary to each other, that is for each ‘A’ on the coding strand there is a ‘T’ on the template strand. For every ‘G’ on the coding strand there is a ‘C’ on the template strand. As in
Thus, the answer, the sequence for the coding strand for given RNA sequence, the sequence of the coding strand is 5’-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3’ and the sequence for the template strand is 3’-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5’.
For the given RNA sequence, the sequence of the coding strand is 5’-ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG-3’ and the sequence for the template strand is 3’-TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC-5’.
Want to see more full solutions like this?
Chapter 30 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
- minute). Since there are 61 sense codons (excluding stop codons), most cells contain 61 different types of tRNAS (one type of tRNA for each sense codon). O True O Falsearrow_forwardRNA sequence. ate 3' and 5' ends on BOTH strands ate which strand served as the TEMPLATE strand and which ING strandarrow_forwardHi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forward
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forwardRNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forward
- 10. A portion of 5'-AUGCCACGAGUUGAC-3'. What amino acid sequence does this code for? To answer the question please: I) explain what is the genetic code and list the properties of the genetic e 2) draw a diagram of protein synthesis; 3) determine which tRNA should be attached to the mRNA; 4) what is the anticodon for the very first tRNA that will attach to mRNA? mRNA molecule has the sequence anarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardPlssss helppppp. Describe the purpose of DNA replication. What is it and why is it important?arrow_forward
- I am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardAnalyzing mRNA Sequences 1. Analyze the following amino acid sequence and write down a potential mRNA sequence from which this sequence might have been translated. Use the codon table in your book to determine a possible mRNA sequence. Amino Acid Sequence 1: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Glutamic Acid-Glutamic Acid- COO 2. (a) Consider Amino Acid Sequence 2. How is Amino Acid Sequence 2 different from Amino Acid Sequence 1? Amino Acid Sequence 2: H,N*-Methionine-Valine-Histidine-Leucine- Threonine-Proline-Valine-Glutamic Acid-CO (b) Write a potential mRNA sequence for Amino Acid sequence 2, using the same codons for any given amino acid if it is present in both sequences.arrow_forwardYes or no? No explanation. rna polymerase are recruiting to start transcription but promoters are DNA sequence. Taq polymerase is enzyme and can synthesize dna at 72 degrees. dna reads 5 to 3 and polymerase reads template 3 to 5.arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning