Biological Science, Loose-leaf Edition (7th Edition)
7th Edition
ISBN: 9780135272800
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Greg Podgorski, Emily Taylor, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 3, Problem 3TYK
What type of information is used to direct different polypeptides to fold into differentshapes?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the following peptide to answer the questions below:
A M A K K E S H I F T A I D E
What is the total charge of this peptide at pH = 5?
What is the N terminal amino acid (full name)? C terminal amino acid?
How many fragments would result if this peptide underwent proteolytic cleavage with V-8 protease and what are these fragments (list them)?
Would this peptide be a candidate to form an alpha helix? Why or why not
Consider the following in light of the concept of levels of structure (primary, secondary, tertiary, quaternary) as defined for proteins. (a) What level is shown by doublestranded DNA? (b) What level is shown by tRNA? (c) What level is shown by mRNA?
How does a polypeptide fold to become a functioning protein?
Chapter 3 Solutions
Biological Science, Loose-leaf Edition (7th Edition)
Ch. 3 - 1. What two functional groups are bound to the...Ch. 3 - What type of information is used to direct...Ch. 3 - Prob. 5TYUCh. 3 - Prob. 6TYUCh. 3 - 7. Why are proteins not considered to be a good...Ch. 3 - Prob. 9TYPSSCh. 3 - Prob. 12PIATCh. 3 - Prob. 13PIATCh. 3 - Recall that proline often introduces kinks in the...Ch. 3 - SOCIETY Based on the experiment in question 15,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the function of the molecular chaperone? What would happen to the protein if molecular machine does not work?arrow_forwardHow do chaperonins assist polypeptides to become fully functional proteins?arrow_forwardWhat is the concept of FoldIt protein folding game, and how is it used to elucidate and visualize protein structures?arrow_forward
- (b) Is the ubiquitination relatively stable or highly dynamic? how does ubiquitination become detached from the protein of interest? what enzyme is involved?arrow_forward* hat do you think holds together the various secondary structural elements in a Particular three-dimensional pattern? (Hint: Look back at Figure 4 - what is sticking out from the sides of the a-helices and B-strands?) glutamic acid B CH, CH valine CH H-N CH H. valine alanine CH2 CH2 lysine Figure 4-4 Essential Cell Biology 3/e (O Garland Science 2010) Figure 6. Three examples of bonding interactions that stabilize the tertiary structures of proteins (indicated by arrows A, B,and C). Copyright 2013 from Essential Cell Biology, 4th Edition by Alberts et al. Reproduced by permission Garland Science/ Taylor & Francis LLC. CH2 CH, SH SH CH2 CH2 OXIDATION CH2 SH REDUCTION SH CH2 CH2 Figure 4-26 Essential Cell Bialogy 3e o Garland Science 2010) Figure 7. Disulfide bonds within proteins can form (left-pointing arrow) or be broken (right- pointing arrow), depending on their chemical surroundings (oxidative or reducing). Copyright 2013 from Essential Cell Biology,4th Edition by Alberts et al.…arrow_forwardAssume that the number of different types of bases in RNA is four. What would be the minimum codon size (number of nucleotides) required to specify all amino acids if the number of different types of amino acids in proteins were (a) 2, (b) 8, (c) 17, (d) 45, (e) 75?arrow_forward
- (a) Draw diagrams to show how the four synthetic oligonucleotides below could base-pair to form a stable model Holliday junction. W 5' GATCGCATTGTAGCCGTAGGTCCACTGTAA 3’ X 5' GTCCCATACGTAGCCGTAGGACATGTACCG 3' Y 5' CGGTACATGTCCTACGGCTACAATGCGATC 3' Z 5' TTACAGTGGACCTACGGCTACGTATGGGAC 3' I and 21arrow_forwardA monomeric protein contains 154 amino acids. How many codons code for these amino acids? How many nucleotides?arrow_forwardCan the tertiary structure of a protein depend on the type of cell system used for synthesis? Explain.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY