Concept explainers
Interpretation:
The activated intermediate present in the linkage of the enzymes, DNA polymerase I, DNA ligase and topoisomerase I are to be stated. The leaving groups present in the enzymes are to be stated.
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). In the formation of recombinant DNA, the restriction enzymes are involved to cut the particular region in the DNA molecule.
Answer to Problem 1P
The activating intermediate present in the linkage of the enzymes, DNA polymerase I, DNA ligase and topoisomerase I are deoxynucleotide triphosphate, DNA adenylate and DNA-tyrosyl intermediate respectively. The leaving groups present in the enzymes, DNA polymerase I, DNA ligase and topoisomerase I are pyrophosphate, AMP and DNA- tyrosine residue respectively.
Explanation of Solution
It is given that the enzymes, DNA polymerase I, DNA ligase and topoisomerase I help in catalyzing the formation of phosphodiaster bonds.
The activated intermediate present in case of DNA polymerase I is deoxynucleotide triphosphate and the leaving group present in this enzyme is pyrophosphate.
The activated intermediate present in case of DNA ligase is DNA adenylate, in which AMP is attached to
The activated intermediate present in case of topoisomerase I is DNA-tyrosyl intermediate, in which
The activating intermediate present in the linkage of the given enzymes are deoxynucleotide triphosphate, DNA adenylate and DNA-tyrosyl intermediate respectively. The leaving groups present in the enzymes are pyrophosphate, AMP and DNA- tyrosine residue respectively.
Want to see more full solutions like this?
Chapter 29 Solutions
SAPLINGPLUS F/BIOCHEM+ICLICKER REEF-CODE
- True or False. Just write T if it is true and F if it is false. In E. coli both RNA and protein synthesis take place in the cytoplasm. Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria. In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons. The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate. The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis. The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes The sigma subunit of the E. coli RNA polymerase confers specificity to transcription. Both DNA replication and transcription follow a 5’ to 3’ direction of polarity. Nucleosomes are the structural unit of chromatin. In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…arrow_forwardTrue or False. Do single-stranded DNA strands stabilize other strands?arrow_forwardPlease help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forward
- transformation and CRISPR. In your own words, briefly describe two differences between these technologies. (For example, these can be differences between their outcomes, procedures, reagents, or something else.)arrow_forwardTRUE OR FALSE. Studies have confirmed that damaged to both the double strands can be reversed via single stranded annealing.arrow_forwardTrue or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forward
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardTRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The 2 subunits of DNA PoI II are called clamp loader and sliding clamps. 2. In eukaryotes, replication and transcription occur in the nucleus, while translation occurs in the cytoplasm.arrow_forwardMay you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.arrow_forward
- need help. For both question 20. The proofreading ability of DNA polymerase which depends on its native exonuclease activity occurs in the: A. 5' to 3' direction B. 3 to 5' direction 21. Direct repair mechanisms in plants involve the enzyme: A Photolvase B. Convertese C. Hydrolase D. Phosphodiesterasearrow_forwardLeaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forwardQuestion 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON