Biological Science (6th Edition)
6th Edition
ISBN: 9780321976499
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Emily Taylor, Greg Podgorski, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 9TYPSS
QUANTITATIVE Imagine a situation in which a morphogen has its source at the posterior end of a Drosophila embryo. Every 100 um from the posterior pole, the morphogen concentration decreases by half. If a cell required l/16th the amount of morphogen found at the posterior pole to form part of a leg, how far from the posterior pole would the leg form?
a. 100 μm
b. 160 μm
c. 400 μm
d. 1600 μm
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
After the initial Actualization of the Cit+ phenotype, there was another alteration to the A-3 genome that resulted in increased growth (e.g. Refinement).
What explained the increase in growth rate in response to Refinement?
A.
Increase number of transporters localized to the plasma membrane.
B.
Increased ability to metabolize glucose.
C.
Increased citric acid cycle activity.
D.
Altered promoter activity resulting in constitutive gene expression.
Draw a diagram to illustrate how a concentration gradient of a transcription factor along the
anterior-posterior axis of a Drosophila embryo can create a region in the middle in which
transcription of a target gene takes place without being transcribed in either the anterior or posterior
region.
The NFAT family is a ubiquitous family of transcription factors.
a. Under resting conditions, where is NFAT localized in a cell?
b. Under activated conditions, where is NFAT localized in a cell?
c. How is it released from its resting condition and permitted to relocalize?
d. Immunosuppressant drugs such as cyclosporin act via inhibition of the calcineurin phosphatase. If NFAT is ubiqitous, how do you think these drugs might act with so few side effects on other signaling processes within the body?
Chapter 21 Solutions
Biological Science (6th Edition)
Ch. 21 - 1. What is apoptosis?
a. an experimental technique...Ch. 21 - In adult animals, ______ are a source of...Ch. 21 - 3. What is a homeotic mutant?
a. an individual...Ch. 21 - 4. A tool-kit gene is _________.
Ch. 21 - CAUTION A friend is interested in isolating genes...Ch. 21 - 6. How is determination distinct from...Ch. 21 - What is the connection between genetic regulatory...Ch. 21 - Which of the following provides the strongest...Ch. 21 - QUANTITATIVE Imagine a situation in which a...Ch. 21 - 10. PROCESS OF SCIENCE Some stickleback fish...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How is the expression of genes controlled at the chromosomal level? A. DNA can synthesize extra histones as needed B. DNA can either be condensed into heterochromatin or decondensed into euchromatin C. DNA can be unwound into euchromatin to reduce the level of expression D. The expression of DNA can only be controlled at the transcriptional level E. DNA is spontaneously deleted from a chromosome if not neededarrow_forwardWhy is regulating transcription the main way that cells control gene expression? A. Because transcription is the last step in gene expression, stopping here ensures that the cell has a stockpile of proteins to prepare them from all unexpected environmental changes. B. Because transcription involves interactions with DNA, preventing transcription reduces the changes of mutation in the cell’s genome. C. Because transcription is the first step in gene expression, stopping at transcription reduces the amount of energy and resources used by producing unnecessary gene products. D. Because transcription is the shortest step in gene expression, preventing transcription has little effect on the rate of protein production.arrow_forwardWhat is the difference between cyclins and kinase proteins? A. Kinases regulates MPF dimer formation and cyclins phosphorylates the kinases in a negative feedback loop B. Cyclins regulate cell cycle, while kinases are enzymes that catalyze phosphorylation of cyclins C. Kinases are enzymes that convert MPF into CDK and the cyclins bind to CDK to send cells into M phase D. Cyclins are enzymes and kinase are proteins that regulate M phasearrow_forward
- Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairarrow_forwardWhich of the following is not an example of constitutively expressed gene? a. genes for cell division and growth b. genes involved in DNA repair c. genes for cellular respiration d. genes that function in ATP synthesisarrow_forwarda) hours: 0 2 567 DMC1 SPS1 hours: 0 2 5 6 7 9 11 DIT1 SPS100 Oxygen level (% normal) b) 120 100 FIGURE 4.6. Comparison of Northern blots with DNA microarray data. a) Results from four individual Northern blots examining four different genes and measuring mRNA production over time, as indicated. b) Results from a series of microarrays for the same four genes of interest. Note the color scale on the bottom of b), where bright green indicates a 20-fold repression and bright red indicates a 20-fold induction. Black indicates no change in transcription (i.e., the merged microarray spot would have appeared yellow). 80 60 40 20 0 1 2 gene X gene Y gene Z 3 1 hour 1.0 1.0 b) 1.0 hours: 0.5 2 5 7 9 11 DMC1 SPS1 DIT1 SPS100 fold repressed >20 10x 3x3x10x >20 1:1 fold induced 4 5 6 7 8 9 10 11 Time (hours) 3 hour 2.2 4.5 1.5 5 9 hour hour 1.0 0.15 0.95 0.05 2.0 2.0 FIGURE 4.7 Transcriptional response of three genes to the gradual loss of oxygen. a) Graph of oxygen con- sumption over time by…arrow_forward
- The body produces a normal amount of testosterone. However, a particular cell you are studying has an unusually low number of testosterone receptors. How might the cell's response to testosterone be affected by its low number of testosterone receptors? A. The cell will activate more protein kinases in response to testosterone exposure than a cell with a normal number of testosterone receptors. B. The cell will make less mRNA in response to testosterone exposure. C. The cell will make less cAMP in response to testosterone exposure. D. The cell’s response to testosterone exposure will be identical to the response of a cell with a normal number of testosterone receptors.arrow_forwardHow is transcription directly controlled in eukaryotic cells? a. through the use of phosphorylation b. by means of apoptosis c. using transcription factors and activators d. when chromatin is packed to keep genes turned on e. None of these are correct.arrow_forwardDraw a diagram to illustrate how a concentrationgradient of a transcription factor along the anterior–posterior axis of a Drosophila embryo can create a region in the middle inwhich transcription of a target gene takes place without beingtranscribed in either the anterior or posterior regionarrow_forward
- Give typing answer with explanation and conclusion Predict the phenotypic effects of mutations, drugs, or other agents that affect a specific signal transduction pathway on the cell, tissue, and organism, given the output of the pathway?arrow_forwardPart A and B A. What below would be likely to lead to cancer development? A) Overexpression of a cell cycle checkpoint inhibitor B) Loss of expression of a growth factor that promotes cell cycle entry C) Overexpression of a receptor tyrosine kinase that promotes cell cycle entry D) Overexpression of a DNA damage repair enzyme E) Loss of expression of a regulatory transcription factor that activates transcription of a cyclin B. Taxols inhibit the proper function of microtubules and are frequently used as chemotherapy drugs. What is the function of microtubules during the cell cycle? A) They promote the G1 to S checkpoint B) They normally inhibit M phase from being completed C) They form the mitotic spindle E) They mediate DNA replication F) They form the cleavage furrow during cytokinesisarrow_forwardMaster regulatory genes play critical roles in development. Predict the MOST likely fate of a fly embryo where master regulatory genes were nonfunctional due to mutation. A. Cell division would stop, and the embryo would halt development. B. The embryo would be a collection of undifferentiated cells because they never get the message that will send them down a determination pathway. C. The embryo would be a combination of differentiated and undifferentiated cells because, even in the absence of a functional master regulatory gene, some cells will differentiate on their own. D. The embryo would continue to develop, but there is a high probability that some limbs may end up in the wrong place in the adult.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY