Prescott's Microbiology
10th Edition
ISBN: 9781259281594
Author: Joanne Willey, Linda Sherwood Adjunt Professor Lecturer, Christopher J. Woolverton Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 19.3, Problem 4RIA
Why is rRNA so suitable for determining relatedness?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Why must tRNA molecules have both unique structural features and common structural features?
What is meant by the statement “The genetic code is universal”? What is the significance of this finding?
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
Chapter 19 Solutions
Prescott's Microbiology
Ch. 19.1 - What is a natural classification? What microbial...Ch. 19.1 - What is polyphasic taxonomy, and what three types...Ch. 19.1 - Consider the finding that bacteria capable of...Ch. 19.2 - What is the difference between a microbial species...Ch. 19.2 - Why is it important to have a type strain for each...Ch. 19.2 - The genus Salmonella was once thought to contain...Ch. 19.3 - MICRO INQUIRY Would this curve be shifted to the...Ch. 19.3 - Why does isolate #2 yield only one DNA fragment...Ch. 19.3 - What are the advantages of using each major group...Ch. 19.3 - Why is it not safe to assume that two...
Ch. 19.3 - Prob. 3RIACh. 19.3 - Why is rRNA so suitable for determining...Ch. 19.3 - Prob. 5RIACh. 19.4 - Could a phylotype be considered an OTU? What about...Ch. 19.4 - List the differences between distance-based and...Ch. 19.4 - Prob. 3RIACh. 19.4 - You are building a tree based on 16S rRNA sequence...Ch. 19.4 - Is HGT involved in movement of genes in the core...Ch. 19.5 - On what evidence is this hypothesis based?Ch. 19.5 - Construct a scenario in which each of the...Ch. 19.5 - Which do you think would have a pan-genome more...Ch. 19.5 - Define ecotype. Do you think it is necessary to...Ch. 19.5 - What is the difference between the core genome and...Ch. 19.5 - Of the following genes, which do you think are...Ch. 19.5 - Prob. 4RIACh. 19.6 - Why is the second edition of Bergeys Manual no...Ch. 19.6 - Describe two different situations in which it...Ch. 19 - Consider the fact that the use of 16S rRNA...Ch. 19 - Bacteria and Archaea were classified phenetically...Ch. 19 - You have recently established a pure culture of a...Ch. 19 - Prob. 4CHICh. 19 - Prob. 5CHICh. 19 - In 2007 a severe food-borne outbreak of...Ch. 19 - Prob. 7CHI
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?arrow_forwardHow many kilobases of the DNA strand below will code for the protein product?arrow_forwardHow is a protein with a proper sequence generated?arrow_forward
- What are the function of initiator Trna?arrow_forwardAn RNA molecule has the following percentages of bases: A = 27%, U = 38%, C=20%, G = 15%. (A) Is this RNA molecule single-stranded or double stranded? How can you tell? (B) What would be the percentage of each of the bases in the template strand of the DNA that contains the gene for this RNA?arrow_forwardIn what ways does the double helix explain the essential properties of a gene?arrow_forward
- If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forwardWhen is a DNA sequence said to be conserved?arrow_forwardFor a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?arrow_forward
- If a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardWhat happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license