What Is Life? A Guide to Biology with Physiology & LaunchPad for What is Life? A Guide to Biology with Physiology (Twelve Month Access)
4th Edition
ISBN: 9781319201821
Author: Jay Phelan
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15, Problem 3SA
Summary Introduction
To review:
The three lateral gene transfer methods in bacteria.
Introduction:
Bacteria possess several methods for the transmission of genes between individual cells. These mechanisms not only generate new assortments, they also help to move genes throughout populations and from species to species.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
. This flowchart helps distinguish among organisms by asking questions that have one of two
possible answers. As a result, this flowchart can also be called a dichotomous key (from Greek
dikho- 'in two' + temnein 'to cut'). Complete the flowchart by properly placing these genera:
Bacillus, Corynebacterium, Escherichia, Mycobacterium, Neisseria, and Staphylococcus. You
may need to look up additional information about these genera.
Gram reaction
Rod-shaped
Negative
Coccus-shaped
Rod-shaped
Positive
Coccus-shaped
Acid-fast Not acid-fast
Spore-former No spores
Which of the following is true about
proteobacteria? Select all that apply.
O they are gram negative
O they are gram positive
O they are typically classified based on their
G+C content
O Agrobacterium is an example of a
proteobacterium
O They are all pathogenic
O None are pathogenic
O Some genera are important members of the
nitrogen cycle
O They are metabolically diverse
Most are extremophiles
O Neisseria is an example of a proteobacterium
Complete the colony morphology for the colonies pictured above:
1. Form -
2. Elevation -
3. Margin -
4. Surface -
5. Chromogenesis -
Chapter 15 Solutions
What Is Life? A Guide to Biology with Physiology & LaunchPad for What is Life? A Guide to Biology with Physiology (Twelve Month Access)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Complete the table below and provide a detailed description of the morphological characteristics and unique features of every microorganism. Classification of Microorganism Name of Microorganism Morphological Characteristics Unique features (habitat, metabolites, structures, etc.) Bacteria 1 Escherichia coli Bacteria 2 Klebsiella pneumoniae Fungi 1 Emericella stellamaris Fungi 2 Aspergillus oryzae Protozoa 1 Green algae (zoochlorellae) Protozoa 2 amoeba (Korotnevella spec.) Virus Bacteriophagesarrow_forwardCyanobacgeria are capable of photosynthesis, so they are usually called blue-green algae. a) true b) falsearrow_forwardAll of the following pertain to archaeobacteria EXCEPT:(a) They include microbes that live in hot acidic environ-ments.(b) All are strict anaerobes.(c) They include microbes that live in extremely saltyenvironments.(d) All lack peptidoglycan in their cell walls.(e) They include microbes that reduce carbon to methanegas.arrow_forward
- State why the followings are important a)plants 2)fungi 3)animals 4)viruses 5)protistsarrow_forwardexplain the principles of systematics in microorganisms i need other answers please explain. i will upvote if u have other explanationarrow_forwardIf your instructor gave you a culture containing one species of a microorganism, how would you be able to tell whether it was an archaean, a bacterium, a fungus, or a protist? Identify and explain characteristics you could use that would allow you to distinguish amongst these types of microorganisms. Assume that you would have available any equipment or technologies needed to identify each organism. TTTT Paragraph v Arial v 3 (12pt) T 只i8公 EST T, - fr Mashups 囲 圈 田 图□mMTML cssarrow_forward
- Characterize and identify the Genus of the following cyanobacterium Genus Identification of Cyanobacterium E Table: Descriptive Characteristics for Genus Identification of the Cyanobacterium E. Morpho-cytological Characteristics Characters 1. Vegetative cell shape (2D) 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. EXT Vegetative cellular arrangement (grouping) Class: Order: Family: Genus: Number of cells in large aggregates (colonies) Layers of trichomes in a filament Presence and shape of a heterocyst in the trichome Presence and shape of akinetes in the trichome Presence of baecytes (endospores) in a colony Polarity and tapering of the trichome Shape of end cells in a filament Presence of a gelatinous or colonial sheath Presence of branching Protoplasm color Protoplasm granulation Thylakoid arrangement if observable (ultrastructural) Diagnostic Key Characteristics for Genus ID using the dichotomous key of Lobban & N'Yeurt (2006) wwwwwwww Latest Classification based on Algaebase…arrow_forwardIdentify the type of cell and cellularity of each microorganism.arrow_forwardYou grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forward
- Which ones apply? coccus, spirillum, vibrio, bacillus, sarcina, tetrad, strepto, spiral, spirochetes, staphyloarrow_forwardcreate your own drawing that provides the types of microorganisms within each category and compares the size of cellular and acellular microorganisms. You must include two microorganisms per category - your submission must demonstrate your understanding of how the sizes and structure of these microorganisms help to classify them as cellular or acellular by adding a brief statement at the bottom of the drawing describing cellular vs acellular please help!arrow_forwardExplain what the following bacteria do: i) nitrogen-fixing bacteria; ii) ammonifying bacteria ; iii) nitrifying bacteria.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Endospore Formation -Biology Pundit; Author: Biology Pundit;https://www.youtube.com/watch?v=6_sinRhE8zA;License: Standard YouTube License, CC-BY
Taxonomy of Bacteria: Identification and Classification; Author: Professor Dave Explains;https://www.youtube.com/watch?v=8IJRzcPC9wg;License: Standard YouTube License, CC-BY