Concepts of Genetics (11th Edition)
Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 13, Problem 1NST

In a mixed heteropolymer experiment using polynucleotide phosphorylase, 3/4G : 1/4C was used to form the synthetic message. The amino acid composition of the resulting protein was determined to be:

Chapter 13, Problem 1NST, In a mixed heteropolymer experiment using polynucleotide phosphorylase, 3/4G : 1/4C was used to form

From this information,

  1. (a) Indicate the percentage (or fraction) of the time each possible codon will occur in the message.
  2. (b) Determine one consistent codon base composition assignment for the amino acids present.

(a)

Expert Solution
Check Mark
Summary Introduction

To determine: The fraction of the time each possible codon will occur in the message formed in the given experiment.

Introduction: The heteropolymer is made up of two different monomers. The mixture of heteropolymers is used for the process of copolymerization. The amino acids are incorporated in a cell-free protein-synthesizing system in a test-tube. The process begins with a cell-lysate containing all the necessary factors for translation. This method was developed to follow the progress of translation for decoding the genetic code by radioactive labeling of one or more amino acids.

Explanation of Solution

In the given experiment, the amino acids are built from a polynucleotide sequence using only G’s and C’s. The proportion of G is ¾, and C is 1/4. The percentage that each codon will appear depends on its nucleotide proportion.

Chance of codon=[(Proportion of first nucleotide)(Proportion of second nucleotide)(Proportion of thirtd nucleotide)]

The fraction for each codon that can occur in the synthetic message is represented as follows:

GGG=3/4×3/4×3/4=27/64

GGC=3/4×3/4×1/4=9/64

GCG=3/4×1/4×3/4=9/64

CGG=1/4×3/4×3/4=9/64

CCG=1/4×1/4×3/4=3/64

CGC=1/4×3/4×1/4=3/64

GCC=3/4×1/4×1/4=3/64

CCC=1/4×1/4×1/4=1/64

Thus, the fractions for the possible codons GGG, GGC, GCG, CGG, CCG, CGC, GCC, CCC are 27/64, 9/64, 9/64, 9/64, 3/64, 3/64, 3/64, and 1/64, respectively.

(b)

Expert Solution
Check Mark
Summary Introduction

To determine: One consistent codon base composition assignment for the amino acids present.

Introduction: Codon is a sequence of three nucleotides that corresponds with a specific amino acid or termination signal during translation. DNA and RNA are written in a language of four nucleotides, while the protein language includes 20 amino acids.

Explanation of Solution

In this problem, we are assuming that the genetic code is not known to us. All the given amino acids except the proline are decoded by more than one codon.

Thus, the proline (CCG) is one consistent codon base composition assignment for the amino acids present.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
The following RNA sequence represents a small messenger which can be translated in a prokaryotic cell: 5'-ACGAAUGCACAGUAAAACUGGCUAGCGUAGGCUGA-3 Assume that the messenger RNA is translated in the cell, using the correct machinery and signals required for accurate protein synthesis. Using this RNA sequence and the Genetic Code Dictionary (see your textbook for the dictionary), solve the following problems A. Write the sequence of a protein that would be translated from this mRNA, using the appropriate stop and start signals, and indicating the correct termini of the protein product. B. Suppose that the underlined A in the sequence is changed to a U. Write the expected protein product of this mRNA.
In HbS, the human hemoglobin found in individuals with sickle-cell anemia, glutamic acid at position 6 in the beta chain is replaced by valine. Q.) Show that one of the glutamic acid codons can be converted to a valine codon by a single substitution mutation (i.e., by changing one letter in one codon).
Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start):  5’- GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’   By in vitro translating the mRNA, you determined that the  translated peptide is 15 amino acids long. What is the expected  peptide sequence in single letter abbreviations?

Chapter 13 Solutions

Concepts of Genetics (11th Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY