Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 13, Problem 16P
Genes encoding toxins are often located on plasmids. A recent outbreak has just occurred in which a bacterium that is usually nonpathogenic is producing a toxin. Plasmid DNA can be isolated from this newly pathogenic bacterial strain and separated from the chromosomal DNA. To establish whether the plasmid DNA contains a gene encoding the toxin, you could determine the sequence of the entire plasmid and search for a sequence that looks like other toxin genes previously identified. An easier way exists to determine whether the plasmid DNA carries the gene(s) for the toxin; this strategy does not involve DNA sequence analysis. Describe this easier method.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The gene atg-12 codes for a protein associated with abnormal rates of cell destruction and recycling of cell contents. Scientists studying bacterial plasmids devised an experiment using recombinant DNA techniques to remove a section of DNA (gene atg-12) of a bacterial plasmid (pOKE103) and create a new plasmid (pOKE104) that did not contain the gene atg-12. The new plasmid was then incorporated within the DNA of the fungus Neurospora crassa in cellular studies.
Which statement explains the expected heredity of fungi that incorporate pOKE104?
A - Fungi that incorporate pOKE104 will produce the protein from gene atg-12 and have increased rates of malignant tumors.
B - Fungi that incorporate pOKE104 will not produce the protein from gene atg-12 but will have a normal appearance.
C - The prokaryotic DNA will remain separate within the fungal cells, produce the protein from gene atg-12, and have increased rates of malignant tumors.
D - The prokaryotic DNA will remain separate within the…
You have set up a recombinant DNA experiment using the plasmid PBR322 as the vector (see plasmid below). You use the BamHI restriction site on the plasmid to insert the target DNA. The
plasmid is then used to transform E.coli colls Is the following statement True or False?
Growth of the transformed cells on agar containing both ampicillin and tetracycline will eliminate any cells that do not contain a plasmid.
Clal Hindlll
EcoRI
Pvul
BamHI
Pstl
amp
tet
PBR322
-Sall
ori
rop
Pvull
True
False
You have two cell cultures, each
containing a different plasmid. The first
plasmid is ~5kbp long and contains three
5'-TCGA-3' and the other is the same size,
but only contains two 5'-TCGA-3'
sequences. You forget to label the two cell
cultures you grew and have to figure out
which one contains each plasmid. How
would you go about identifying the the
two cultures.
Chapter 13 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 13 - Choose the phrase from the right column that best...Ch. 13 - Prob. 2PCh. 13 - Now that the sequence of the entire E. coli K12...Ch. 13 - Bacterial genomes such as that of E. coli...Ch. 13 - List at least three features of eukaryotic genomes...Ch. 13 - Describe a mechanism by which a gene could move...Ch. 13 - High salt concentrations tend to cause protein...Ch. 13 - Prob. 8PCh. 13 - A liquid culture of E. coli at a concentration of...Ch. 13 - Pick out the medium i, ii, iii, or iv onto which...
Ch. 13 - Prob. 11PCh. 13 - In two isolates one is resistant to ampicillin,...Ch. 13 - E. coli cells usually have only one copy of the F...Ch. 13 - In E. coli, the genes purC and pyrB are located...Ch. 13 - DNA sequencing of the entire H. influenzae genome...Ch. 13 - Genes encoding toxins are often located on...Ch. 13 - a. You want to perform an interrupted-mating...Ch. 13 - Prob. 18PCh. 13 - One issue with interrupted-mating experiments such...Ch. 13 - Prob. 20PCh. 13 - Starting with an F- strain that was prototrophic...Ch. 13 - You can carry out matings between an Hfr and F...Ch. 13 - Genome sequences show that some pathogenic...Ch. 13 - Generalized and specialized transduction both...Ch. 13 - Prob. 25PCh. 13 - Prob. 26PCh. 13 - Prob. 27PCh. 13 - The sequence at one end of one strand of the...Ch. 13 - Prob. 29PCh. 13 - Suppose that you could obtain radioactively...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You are about to isolate a 3000 bp large plasmid from an E.coli culture. You know that the plasmid is present in 100 copies per E. coli cell. You aim to have a final plasmid concentration of 100 ng/µl in a total volume of 50 µl. Assuming the yield is 100 %, how many E. coli cells should the culture from which the plasmid is to be isolated at least containarrow_forward1) Given the image below, describe what is happening at each of the 3 sections (i.e. 1, 2, and 3) . [In section 1, the gene donor is providing..., In section 2..., In section 3...]arrow_forwardDescribe how restriction enzymes like EcoR1 are used to create recombinant plasmids and what the process is for using these plasmids to replicate a piece of target DNA. Include information about how to create sticky ends, the makeup of the bacterial plasmid and how to tell if the gene was successfully inserted in the plasmid and if the plasmid has been transformed by the bacteria. You may use a drawing to enhance your description.arrow_forward
- Which of the following is NOT a mechanism by which plasmids inerease the possibility of being present in the new generation of cells? A) O They can be present at a high number so that some copies will end up in each new cell after cell division. B) O They encode traits such as antibiotic resistance that are required for growth in some environments. C) O They cause the cell to replicate much more rapidly than cells that do not have plasmids. D) O They may carry host survival genes and self-preservation genes.arrow_forwardIn bacterial transformation, the purpose of having antibiotic within an agar plate is to: Select one: confirm which plasmids been have successfully ligated with a gene of interest. isolate bacteria which have been successfully transformed with the plasmid. indicate which plasmids were successfully digested by the endonuclease. act as a substrate which will be cleaved and produce a blue product when ligation is unsuccessful. show which plasmids contain the lacZ gene.arrow_forwardScientists modified the tumor-inducing (Ti) plasmid, a naturally occurring plant plasmid found in Agrobacterium tumefaciens, to create a tool used to introduce any gene of interest into plant cells. They created a binary system because a single Ti plasmid is too large to be easily manipulated. One part of the system is a disarmed plasmid, and the second part is a transformation vector. The following sentences describe the function of key DNA elements in the system. Virulence region Genes for conjugative transfer Disarmed Ti plasmid (T-region removed) ori Kan selectable marker plant selectable marker constitutive promoter T-region conjugative transfer virulence Kan (bacterial selectable marker) Amp selectable marker Plant selectable marker (e.g., herbicide resistance) Constitutive promoter T-DNA left border Place the terms in the appropriate blanks to complete the sentences. Not all terms will be used. 3' transcriptional terminator MCS (inserted gene of interest) T-region Transformation…arrow_forward
- Bacteria exposed to viruses incorporate sections of the virus’s DNA into the CRISPR array sequences in their genome. This mechanism allows bacteria to fight off the viruses, like an immune response: the information in CRISPR spacers served as “coordinates” for recognizing and cutting up invading DNA sequences. Describe what might happen under the conditions described after a bacteriophage infects a bacterial cell and releases its DNA into the bacterial cell. Explain why: 1. The invading phage DNA is recognized by the Cas proteins but not inserted into the CRISPR array region of the bacterial genome: The bacteria will be unable to elicit an immune response and will succumb to the phase infection 2. The cas genes on the bacterial genome contains a missense mutation that increases its cleavage/cut activityThe bacteria will elicit an immune response that will successfully fight the phage infectionarrow_forwardAssume that there are horizontal gene transfers between two completely different bacterial species. In one case it is a plasmid that is transmitted via conjugation, in the other case it is it is a part of the bacterial chromosome that is transferred via transformation. In which of the two cases is it likely that the transferred DNA will be present? left and can function in the recipient cells? Explain the biological background to your answerarrow_forwardThe genes for both the α- and βglobin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for α-globin into a bacterial plasmid and have the bacteria produce α-globin?arrow_forward
- A researcher has a Trp− auxotrophic strain of E. coliwith a mutation in a single gene. To identify thatmutant gene, she uses a genomic library made from a wild-type version of that same strain to find plasmids that rescue the mutant phenotype. The result issurprising. She recovers 10 plasmids that provide aTrp+ phenotype, but six of the plasmids contain geneX, while the other four contain gene Y. Our scientisthas encountered a phenomenon called multicopysuppression, related to the fact that plasmids are usually present in several copies per bacterium. Becausethe genes in the plasmids are present in more thantheir usual single copy in the bacterial chromosome,more than the usual amount of Protein X or Protein Yis being produced from the plasmids. Sometimes,overexpression of one protein can rescue the mutantphenotype caused by loss of a different protein.Suggest at least two ways that our scientist could determine which of the two genes, gene X or gene Y, actually corresponds to the…arrow_forwardA shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two different host species. One of the most common types of shuttle vectors is the yeast shuttle vector. Examples of such vectors derived from yeast are Yeast Episomal Plasmid (YEP), Yeast Integrating Plasmid (YIP) and Yeast Replicating Plasmid (YRP). Why is YEP preferred over YIP and YRP? Give your thoughts on this.arrow_forwardMany resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license