Concept explainers
Videos
Genes may be protein-encoding genes that encode polypeptides, orthey may not.
Describe three examples of genes that are not protein-encodinggenes.
For protein-encoding genes, one DNA strand is called the template strand, and the complementary strand is called the codingstrand. Are these two terms appropriate for genes that do notencode proteins? Explain.
Do genes that do not encode proteins have a promoter andterminator?
To analyze:
The gene is a segment of the DNA, and it can be protein encoding or non-protein encoding. The protein encoding genes encode polypeptides.
a. What are the three non-protein encoding genes?
b. The DNA has a template and complementary strand for protein-encoding genes. The template strand is also known as an antisense strand while the complementary strand is the sense strand or coding strand. Are these terms significant to non-protein encoding genes?
c. Do non-protein encoding genes possess any promoter and terminator?
Introduction:
The main role of DNA is to store hereditary material. Gene is termed as this information is stored in units.
Gene is the segment of the DNA that governs the protein synthesis in an organism.
The genes that are protein encoding are also known as structural genes. These protein-encoding genes carry the amino acid sequence that gets translated into proteins.
Explanation of Solution
The information of DNA into proteins has sequential events termed as central dogma. This central dogma carries out two processes named as Transcription and Translation. The first process is the Transcription; it is the process of copying the information of DNA specifically from the template strand that runs in the direction of
Genes that are protein encoding are also known as structural genes. These protein-encoding genes carry the amino acid sequence that gets translated into proteins. Overall
a. The three non-protein encoding genes are ribosomal RNA (rRNA), transfer RNA (tRNA) and the micro RNA genes. The ribosomal RNA is made to form the functional ribosomes that are crucial factors required to accomplish protein synthesis. Transfer RNA playsan important role in the translation process by recruiting the correct anticodon or amino acids at the translation site. The micro RNA & small interference RNA (siRNA) has vital roles in the regulation of gene expression of eukaryotes.
b. Both the terms are significant to non-protein encoding genes because overall, all the genes undergo transcription process. In this process, the template strand of DNA is copied by mRNA. The template strand of DNA will show a sequence similarity to mRNA except for the bases; T is replaced by U.
c. All the genes must have a promoter and terminator in order to undergo the process of transcription. The initiation of transcription requires the promoter and terminator to stop the process. Hence, the genes that do not encode a protein will also have a promoter and terminator.
All the aspects are determined.
Want to see more full solutions like this?
Chapter 12 Solutions
Genetics: Analysis and Principles
- Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.arrow_forwardHelp me pleasearrow_forwardThe chromosomal sequences of two mutant alleles of gene A from patients with the zero subtype include the following mutation: 496G>A. Briefly discuss why this mutant fails to produce a functional protein. Note that none of the mRNA transcribed from this gene is of the expected size; some of the mRNA molecules produced are 223 nucleotides shorter than expected whilst others are 47 nucleotides longer than expected. The mutation on position 496 is highlighted in yellow, this will become A instead of G. However, it is the start of an intron, therefore the mutation won't affect the protein. but the question implies that the mutation will affect the protein.arrow_forward
- There are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ.a) Predict the outcome or consequences of mRNA transcription by RNA polymerase II in eukaryote without the presence of transcription factors (TF).arrow_forwardIn a mutant mouse, it was discovered that a gene "W" is moved from its original chromosomal locus to the telomere region, where chromatin is packed into heterochromatin. Given what we have learned about eukaryotic gene regulation, can you speculate how the expression of gene W in the new mouse line would be changed as compare to the normal mouse? elevated in the mutant mouse than in the wild-type mouse. cannot be determined. O reduced in the mutant mouse than in the wild-type mouse. change in the mutant mouse as compared to the wild-type mouse.arrow_forwardShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. Question 6: How many amino acids are present in the wild-type human B-globin protein? = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription 3' 5' ATG 50 TẠC TAA 126 132 |ATT 90 130 222 850 3 5' Start codon Stop codon А. 438 В. 146 C. 620 D. 206 © 2013 John Wiley & Sons, Inc. All rights reserved.arrow_forward
- Help me pleasearrow_forwardLike Hurler syndrome, Fabry disease involves an abnormal accumulationof substances within lysosomes. However, the lysosomesof individuals with Fabry disease show an abnormal accumulationof lipids. The defective enzyme is α-galactosidase A, which is alysosomal enzyme that functions in lipid metabolism. The enzymaticdefect causes cell damage, especially to the kidneys, heart,and eyes. The gene that encodes α-galactosidase A is found on theX chromosome. Let’s suppose a phenotypically unaffected coupleproduces two sons with Fabry disease and one phenotypicallyunaffected daughter. What is the probability that the daughter willhave an affected son?arrow_forwardYou are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expressionarrow_forward
- What are the functions of transcriptional activator proteins and repressor proteins? Explain how they work at the molecular level.arrow_forwardThe following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forward
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education