Concept explainers
Your bone cells, muscle cells, and skin cells look different because
- a. different kinds of genes are present in each kind of cell.
- b. they are present in different organs.
- c. different genes are active in each kind of cell.
- d. different mutations have occurred in each kind of cell.
Introduction:
Almost all the cells in an organism are genetically identical bit different types of cells looks different result from differential gene expression. Genes are expressed by turning on and turning off its expression as a result of interaction with regulatory proteins. Each cell type contains a unique set of proteins that regulates the gene expression by controlling different levels; transcriptional level, processing level and translational level.
Answer to Problem 1SQ
Correct answer:
Eukaryotic and multicellular organism regulates gene expression to maintain different cell types during embryonic development. Therefore option c. is correct.
Explanation of Solution
Reason for correct statement:
The control of gene expression makes it possible for cells to produce specific kind of proteins that make different type of cells with the organism even if their genetic composition is same.
Option c. is given as “different genes are active in each kind of cell”.
As, in eukaryotic organisms each cell maintain differential gene expression; the bone cells, muscles cells and skin cells looks different as the differential gene expression provide them with expression of different protein responsible for particular characters. It is the right answer.
Hence, option c. is correct.
Reasons for incorrect statements:
Option a. is given as “different kinds of genes are present in each kind of cell”.
As all the cells preset in an organism contain similar genetic composition and so have identical genes. So it is a wrong answer.
Option b. is given as “they are present in different organ”.
As, different cells responsible to provide different functions to organs by expressing different genes and organs, they are not responsible for cells diversity in the body. So it is a wrong answer.
Option d. is given as “different mutations have occurred in each kind of cells”.
As, mutation is responsible for altering the function in a gene present in the cell; it cannot be associated with diversity of cells present in the organism’s whole body. So it is a wrong answer.
Hence options a., b., and d. are incorrect.
The bone cell, muscles cells and skins cells look different as they control their gene expression by differential expression that different kind of proteins and provide them different structure and functions.
Want to see more full solutions like this?
Chapter 11 Solutions
Campbell Essential Biology with Physiology (5th Edition)
Additional Science Textbook Solutions
SEELEY'S ANATOMY+PHYSIOLOGY
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
Genetics: From Genes to Genomes
Campbell Essential Biology (7th Edition)
- A genetic researcher notices that individuals with a particular genetic disease have a shortened version of key protein involved in the diseased biochemical pathway. Which of the following mutations is most likely to result in the premature termination of protein synthesis? A. The disease is caused by a silent mutation. B. The disease is caused by a frameshift mutation. C. The disease is caused by a missense mutation. D. The disease is caused by a nonsense mutation.arrow_forwardGenetic Engineering is being used by the pharmaceutical industry. Which of the following is NOT currently one of the uses? Group of answer choices a. creation of products that will remove poisons from the bocy b. production of human insulin c. No answer text provided. d. production of human growth hormone e. genetic modification of plants to produce vaccinesarrow_forwardWhich of the following is NOT true about mutations? A. Mutations can be harmful but not beneficial to the cell B. Nucleotide substitution in DNA can cause nonsense mutations C. Nucleotide substitution in DNA can cause missense mutations D. Mutagens increase the rate of mutation, but mutations are still random E. Nucleotide insertion or deletion in DNA can cause frameshift mutationsarrow_forward
- The process of gene expression involves:arrow_forwardWhich of the following statements about genes is incorrect? Select one: O a. During fertilization, both the sperm and the ovum contribute genes to the resulting fertilized egg. b. Genetic differences can result from changes in the DNA called mutations. O c. Genes correspond to segments of DNA. d. Under normal circumstances, each chromosome contains precisely one gene. e. Many genes contain the information needed for cells to synthesize enzymes and other proteins.arrow_forward1a) Why is it possible for you to study the eye colour gene by extracting cheek cells? a. Because the nucleus of every cell in the human body contains the same genetic information. b. Because the cheek cells are located near the cells of the eye and so they are able to exchange DNA. c. Because all genes in the human body are expressed at all times so it is easy to study them. d. All of the above are possible explanations. 1b) What is the purpose of heating the sample to 75°C following addition of the 0.2M NaOH solution? a. To denature the histone proteins that are keeping the DNA tightly coiled. b. To ensure that all the DNA is removed from the swab in preparation for PCR. c. To breakdown the cheek cell membrane to release the DNA from the cell. d. It breaks down the circular DNA down into linear fragments so that they will be easier to visualize.iarrow_forward
- Gene expression is a term that relates to Select one: A. DNA replication. B. the flow of genetic information from DNA to proteins. C. how genes are passed from parent to offspring. D. the unique set of genes in an individual.arrow_forwardAlthough it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?arrow_forward1. (a) RNA polymerase synthesis in a 5 -3 direction Gene is switched ON Gene is switched OFF Does NOT affect the gene expression (b) DNA synthesis in a 5 -3 direction Gene is switched ON Gene is switched OFF Does NOT affect the gene expressionarrow_forward
- Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardGenetically modified foods may contain high amounts of essential vitamins and minerals; however, genetically modified foods are not always labeled as such. Why is the use of genetically modified foods a concern? Most foods contain enough vitamins and minerals already. B Important nutrients will be more available to all people. C New allergens of which people are unaware may be introduced. D Harmful mutations will be prevented by consuming these foods.arrow_forwardGene therapy is currently a fairly expensive treatment. For rare conditions, the fewer the people treated, the more expensive the treatment will be. But whatis the right price for a cure?arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning