Concept explainers
Your bone cells, muscle cells, and skin cells look different because
- a. different kinds of genes are present in each kind of cell.
- b. they are present in different organs.
- c. different genes are active in each kind of cell.
- d. different mutations have occurred in each kind of cell.
Introduction:
Almost all the cells in an organism are genetically identical bit different types of cells looks different result from differential gene expression. Genes are expressed by turning on and turning off its expression as a result of interaction with regulatory proteins. Each cell type contains a unique set of proteins that regulates the gene expression by controlling different levels; transcriptional level, processing level and translational level.
Answer to Problem 1SQ
Correct answer:
Eukaryotic and multicellular organism regulates gene expression to maintain different cell types during embryonic development. Therefore option c. is correct.
Explanation of Solution
Reason for correct statement:
The control of gene expression makes it possible for cells to produce specific kind of proteins that make different type of cells with the organism even if their genetic composition is same.
Option c. is given as “different genes are active in each kind of cell”.
As, in eukaryotic organisms each cell maintain differential gene expression; the bone cells, muscles cells and skin cells looks different as the differential gene expression provide them with expression of different protein responsible for particular characters. It is the right answer.
Hence, option c. is correct.
Reasons for incorrect statements:
Option a. is given as “different kinds of genes are present in each kind of cell”.
As all the cells preset in an organism contain similar genetic composition and so have identical genes. So it is a wrong answer.
Option b. is given as “they are present in different organ”.
As, different cells responsible to provide different functions to organs by expressing different genes and organs, they are not responsible for cells diversity in the body. So it is a wrong answer.
Option d. is given as “different mutations have occurred in each kind of cells”.
As, mutation is responsible for altering the function in a gene present in the cell; it cannot be associated with diversity of cells present in the organism’s whole body. So it is a wrong answer.
Hence options a., b., and d. are incorrect.
The bone cell, muscles cells and skins cells look different as they control their gene expression by differential expression that different kind of proteins and provide them different structure and functions.
Want to see more full solutions like this?
Chapter 11 Solutions
Campbell Essential Biology with Physiology (5th Edition)
Additional Science Textbook Solutions
Biological Science (6th Edition)
Human Biology: Concepts and Current Issues
Biological Science
Human Biology: Concepts and Current Issues (8th Edition)
Microbiology: Principles and Explorations
- You are working in a lab that studies stickleback fish. These fish normally have three spines that occur on the back of the stickleback. One day you notice that a young stickleback has no spines on its back but instead has three spines growing out of the top of its head! (answer both questions) question 1: A mutation in what type of gene is probably the cause of this unusual situation? Why? question #2: would you expect the proteins that make the spines to be different in the mutant fish compared to a wildtype fish. Why or why not?arrow_forwardA genetic researcher notices that individuals with a particular genetic disease have a shortened version of key protein involved in the diseased biochemical pathway. Which of the following mutations is most likely to result in the premature termination of protein synthesis? A. The disease is caused by a silent mutation. B. The disease is caused by a frameshift mutation. C. The disease is caused by a missense mutation. D. The disease is caused by a nonsense mutation.arrow_forward5)What are the characteristics of stem cells? (Select ALL that apply) Select one or more: a. They have the potential to develop into different cell types. b. They have the ability to make more stem cells. c. They have the potential to develop into any cell type in the human body. d. When certain genes are turned on, stems cell undergo differentiation. e. Stem cells can divide indefinitelyarrow_forward
- A.) There is no change in the DNA sequence if nucleotides are added or removed, it will have no effect to the cell. B.) Mutations in the DNA sequence are all irreversible. A. Statement A is correct B. Statement B is correct C. Both A and B are correct D. Both A and B are incorrectarrow_forwardThe process of gene expression involves:arrow_forward1a) Why is it possible for you to study the eye colour gene by extracting cheek cells? a. Because the nucleus of every cell in the human body contains the same genetic information. b. Because the cheek cells are located near the cells of the eye and so they are able to exchange DNA. c. Because all genes in the human body are expressed at all times so it is easy to study them. d. All of the above are possible explanations. 1b) What is the purpose of heating the sample to 75°C following addition of the 0.2M NaOH solution? a. To denature the histone proteins that are keeping the DNA tightly coiled. b. To ensure that all the DNA is removed from the swab in preparation for PCR. c. To breakdown the cheek cell membrane to release the DNA from the cell. d. It breaks down the circular DNA down into linear fragments so that they will be easier to visualize.iarrow_forward
- Several large studies have shown that daily doses of aspirin protect against colon cancer. This type of study reinforces the link between ________________ and ____________ . (A) mutations, polyps (C) aspirin, stomach upset(B) cancer, diet (D) cancer, chronic inflammation immune check point inhibitors are ____________ which ______________. (A) chemicals, activate T cells (C) antibodies, activate T cells (B) chemo drugs, kill tumor cells directly (D) enzymes, break up tumors Increased colonoscopies has led to earlier detection of colon cancer. However, recent studies have shown that less expensive, lower-tech options like ___________ offer nearly the same screening benefit. (A) flexible sigmoidoscopy (C) CT scans(B) fecal occult stool testing (D) fecal DNA testing PSA testing and mammography have led to undertreatment. (A) True (B) Unclear (C) False The chromosomal location of the APC gene was originally identified by finding a region of the genome that was _________ in patients with…arrow_forwardAlthough it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?arrow_forwardWith regard to human cancer cells, which of the following statements is true? A. Cancer cells within one tumor usually do not share common mutations B. Cancer cells generally have lost the ability to divide C. Oncogenes are non-human genes not related to normal genes in the human genome D. Mutations in DNA repair genes result in an increased chance of getting cancer.arrow_forward
- Of those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardI believe that there are many good things that can come out of people getting to design their baby’s genetic material. But there are also many bad things as well. From the article by Bio medical about the pros and cons of having a designer baby it states that a pro is that this type of engineering can “ might help prevent genetic diseases such as Alzheimer’s, Huntington’s Disease, down syndrome, Spinal Muscular Atrophy, and many others”. I think that it is great that we could get rid of Alzheimer’s due to how destructive it can be to the people that suffer it. But I think the other diseases that it can eliminate is horrible due to them making our world a more unique place such as people with autism, Down syndrome. By doing this it could eliminate the whole population of people with disabilities community and make everyone “normal”. Another bad that I found in the article Ethics of designer babies which states that a major flaw for these babies is “designer baby technologies suggest…arrow_forwardGenetically modified foods may contain high amounts of essential vitamins and minerals; however, genetically modified foods are not always labeled as such. Why is the use of genetically modified foods a concern? Most foods contain enough vitamins and minerals already. B Important nutrients will be more available to all people. C New allergens of which people are unaware may be introduced. D Harmful mutations will be prevented by consuming these foods.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning