Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |
Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
Biology: The Essentials
- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.garrow_forwardWhich of the following sequences, when combined with itscomplement, would be clipped by a restriction endonuclease?a. ATCGATCGTAGCTA b. AAGCTTCGAA c. GAATTC d. ACCATTGGAarrow_forwardLook at the amino acid chart below that the proctor placed on a board at the front of the classroom before asking the students questions. Help Arcel characterize the DNA mutation (HbS) according to its amino acid and position. a The disease is caused by GAG20→GTG20. b The disease is caused by val6→gln6. c The disease is caused by glu6→ val6. d The disease is caused by glu20→ val20.arrow_forward
- What are the sticky ends of the restriction fragments? Select one: a. The surfaces of sticky ends contain matching base pairs, allowing fragments to splice. b. The surfaces of sticky ends have glue like substance that allow fragments to splice. c. The surfaces of sticky ends contain the exact same nucleotides, allowing fragments to bond. d. The surfaces of sticky ends have velcro like structure, allowing fragments to bond.arrow_forwardWhich of the following is not a DNA sequence? a. TAG b. AUGAUUCT d. AAAAAAAAAA e. CGGarrow_forwardWhich of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'- AAATTTGGGCCCTTTGGGAAACCC-3, and lead to successful elongation? Select one: O a. 5'-GGGTTTCCC-3" O b.3'-GGGTTTCCC-5" O c. 5'-AAATTTGGG-3 O d.3'-AAATTTGGG-5 O e. 5'-CCCAAAGGG-3"arrow_forward
- If you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. AAAAAATTTTTCCCCCGGGGG O c. GGGGGCCCCCAATTCCCCCCC O d. TACТАСАСTGTGGTTААТТААA O e. GCGCGCGCGCGCGCGCGCGCG ype here to search Chparrow_forwardDescribe What are the sticky ends of the restriction fragments? Select one: a. The surfaces of sticky ends contain matching base pairs, allowing fragments to splice. b. The surfaces of sticky ends have glue like substance that allow fragments to splice. c. The surfaces of sticky ends contain the exact same nucleotides, allowing fragments to bond. d. The surfaces of sticky ends have velcro like structure, allowing fragments to bond.arrow_forwardThe other options are: a. RNA cannot be digested by restriction enzymes b. RNA is small enough to be resolved on an agarose gel without the need for restriction digestion. c. RNA is single stranded and DNA is double strandedarrow_forward
- in Cohen-Boyer's recombinant DNA procedure _______ must be used for both the bacterial DNA and the amphibian DNA _______. a. the same restrictions enzyme, so that the the restriction site are identical in the DNA of each species b. different restriction enzymes, so that the genes outside the restriction site are maintained c. the same restriction enzymes, to ensure that the newly formed DNA can replicate d. different restriction enzymes, to ensure that the newly introducted genes are maintained in the bacterial DNAarrow_forwardThe double stranded DNA sequence of a restriction enzyme cut site is typically complementary, antiparallel, and palindromic. Given these criteria, which one of the following single stranded sequences represents a restriction enzyme cut site when made double stranded? a. None of these sequences satisfy the given criteria b. 5' – GTCCTG – 3' c. 5' – GTCGTC – 3' d. 5' – GTCGAC – 3' e. 5' – GGTTCC – 3'arrow_forwardFeatures of restriction enzymes include the following, except __________ . a. They are produced by both prokaryotes and eukaryotesb. may be type IIc. make single and double stranded breaks in DNAd. operate at a single temperaturee. Are used in nature to destroy bacteriophage DNAarrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education