Biology: The Unity and Diversity of Life (MindTap Course List)
15th Edition
ISBN: 9781337408332
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 10, Problem 6SQ
Summary Introduction
Introduction: Eukaryotic gene expression is a process where the proteins are expressed and regulated in the eukaryotic cell. In a developing stage, the embryo differentiates its cells into specialized cell types based on the protein expressed in them. A control over the eukaryotic gene drives the embryonic development.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The sigma subunit of bacterial RNA polymerase _____.
a. binds to a bacterial gene’s promoter
b. is composed of both polypeptide and RNA molecules
c. is required for termination of transcription
d. is required for RNA polymerization
e. is required for ribosomal binding
Mechanisms that govern gene expression do not operate during______ . a. transcription c. translation b. RNA processing d. knockouts
Gene expression does not vary by_______ . a. cell type c. stage of development b. extracellular conditions d. the genetic code
Chapter 10 Solutions
Biology: The Unity and Diversity of Life (MindTap Course List)
Ch. 10 - Effect of Paternal Grandmother's Food Supply on...Ch. 10 - Effect of Paternal Grandmother's Food Supply on...Ch. 10 - Effect of Paternal Grandmother's Food Supply on...Ch. 10 - Gene expression does not vary by ___ . a. cell...Ch. 10 - Binding or ___ to ___ in DNA can increase the rate...Ch. 10 - Muscle cells differ from bone cells because they...Ch. 10 - Prob. 4SQCh. 10 - Mechanisms that govern gene expression do not...Ch. 10 - Prob. 6SQCh. 10 - Prob. 7SQ
Ch. 10 - Prob. 8SQCh. 10 - Which of the following includes all of the others?...Ch. 10 - Prob. 10SQCh. 10 - Prob. 11SQCh. 10 - A cell with a Barr body is ___ . a. a bacterium b....Ch. 10 - Prob. 13SQCh. 10 - Which of the following statements is incorrect? a....Ch. 10 - Prob. 15SQCh. 10 - Explain why somebut not allof an organism's genes...Ch. 10 - Do the same mechanisms that govern gene expression...Ch. 10 - Prob. 3CTCh. 10 - The photos below show flowers from two Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Proteins that influence RNA synthesis by binding directly to DNA are called_____ . a. promoters c. operators b. transcription factors d. enhancersarrow_forwardOperons______ . a. only occur in bacteria b. include multiple genes c. involve selective gene expressionarrow_forwardControl of gene expression in eukaryotic cells occurs at which level(s)? Lüffen birini seçin: a. epigenetic and transcriptional levels O b. post-transcriptional, translational, and post-translational levels O c. only the transcriptional level O d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels O e. epigenetic, transcriptional, and translational levelsarrow_forward
- Can you explaint it?arrow_forward7. Methyl groups attached to the DNA can ____a. Cause mutation of the DNA sequenceb. Regulate the timing and degree of gene expressionc. Relax the DNA and promote binding of transcription factorsd. Degrade the gene to which it is attached and inhibit its translation?arrow_forwardMatch the terms with the most suitable description. ___ operon a. makes a man out of you ___ Circadian rhythm b. binding site for repressor ___ Barr body c. can be epigenetic ___ differentiation d. inactivated X chromosome ___ mRNA zip code e. controls multiple genes ___ DNA methylation f. localization mechanism ___ eyeless g. speeds transcription ___ activator h. required for eye formation ___ SRY gene i. effect of regulatory loops ___ operator j. cells become specializedarrow_forward
- A mutation in the Ras protein could directly affect improper _____ Select one: a. cell signaling leading to alterations in cell division b. cell signaling leading to alterations proteasome activity c. microtubule assembly leading to faulty cell division d. protein degradation during the cell cycle e. protein phosphorylation in the cell cyclearrow_forwardEnergy that drives transcription is provided mainly by_____ . a. ATP c. GTP b. RNA nucleotides d. RNA polymerasearrow_forwardProteins that regulate gene expression by directly binding to the DNA are known as _____. a. transcription factors b. transposable elements c. translation factors d. phosphorylation e. methylationarrow_forward
- 4e. You also study the expression of 3 different mutants for this gene. For each mutant answer the following: Does this mutation change the sequence of the protein produced? Why or why not? If it does change the sequence of protein be sure to write out the new sequence. If it does not change the protein sequence, what effect (if any) would you expect it to have on expression of the gene? 1 20 ORI 40 60 5..ТТCGAGCTСТСGТCGTCGAGATACGCGATGATATTACTGGTААТАТGGGGATGCАСТАТС..3' 3'...AAGCTCGAGAGCAGCAGCTCTАTGCGСТАСТАТААТGACCATTATAССССТАСGTGATAG..5' * promoter i. Mutant A has a single base pair substitution with the T/A being replaced with C/G base pair at position 35 (position denoted by the * in the sequence above). ii. Mutant B has a 2 G/C pairs inserted between position 19 and 20 (position denoted by the ^ in the sequence above).arrow_forwardHomeotic genes ___. Select one: a. only specify the anterior-posterior axis for each fruit fly segment b. are found only in Drosophila and other arthropods c. encode transcription factors that control the expression of genes responsible for specific anatomical structures d. are responsible for the programmed cell death occuring during morphogenesis Which of the following are some of the viruses' subversive strategies in manipulating human immune system? Select one: a. down-regulation of the expression of MHC molecules b. degradation of the immune system's chemokine signals c. both a and b d. none of the abovearrow_forwardTable of the Standard Genetic Code Middle base 5'- C_-3' UCU Ser (S) |UAU Tyr (Y) UCC Ser (S) UAC Tyr (Y) UCA Ser (S) UCG Ser (S)UAG Ter CCU Pro (P) CAU His (H) CCC Pro (P) CCA Pro (P) CAA GIn (Q) CCG Pro (P) CAG GIn (Q) 5'- _U -3' 5'-_A_-3' 5'-_G_-3' 5'-U_-3' UUU Phe (F) 5'-U_-3' UUC Phe (F) 5'-U_-3' |UUA Leu (L) 5'-U_-3' UUG Leu (L) 5'-C_-3' |CUU Leu (L) 5'-C_-3' |CUC Leu (L) 5'-C_-3' CUA Leu (L) 5'-C_ -3' CUG Leu (L) UGU Cys (C) 5'-_U-3' 5'-_C-3' 5'-_A-3' UGG Trp (W) 5'-_G-3' 5'- U-3' 5'-C-3' 5'-_A-3" 5'- G-3' 5'- U-3' 5'-_C-3' 5- А-3' 5'-_G-3' GCU Ala (A) GAU Asp (D) GGU Gly (G) 5'-_U-3' 5'-C-3' GGA Gly (G)5'-_A-3' GGG Gly (G) 5'-_G-3' UGC Cys (C) UGA Ter UAA Ter CGU Arg (R) CGC Arg (R) CGA Arg (R) CGG Arg (R) ACU Thr (T)|AAU Asn (N) AGU Ser (S) AAC Asn (N) AGC Ser (S) AGA Arg (R) AGG Arg (R) CAC His (H) 5'-A_-3' |AUU lle (1) 5'-A_-3' AUC Ile (1) 5'-A_-3' |AUA lle (1) 5'-A_-3' |AUG Met (M) ACG Thr (T) AAG Lys (K) 5'-G_-3' GUU Val (V) 5'-G_-3' GUC Val (V) 5'-G_-3' GUA Val (V)…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY