BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 10, Problem 4CT
The photos below show flowers from two Arabidopsis plants. One plant is wild-type (unmutated); the other carries a mutation in one of its ABC floral identity genes. This mutation causes sepals and petals to form instead of stamens and carpels. Refer to Figure 10.7 to decide which gene (A, B, or C) has been inactivated by the mutation.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can you answer part a-c if its true or false
a) the AP3 and PI show auto- and cross-regulatory interactions, as well as they form obligate heterodimers to carry out the B class gene function. Therefore, if there is no PI expression, AP3 expression alone is not sufficient for establishing the petal and stamen identities.
b) Angiosperm is a group of plants whose seeds are borne within a mature ovary (fruit).
c) The organ in different organisms under every variety of forms and functions due to evolutionary development from the same or a corresponding part in a common ancestor is homologous.
You are a developmental geneticist studying flowering time variation in Arabidopsis. You perform a
mutagenesis screen to identify mutants in the photoperiod pathway. You conduct the screen and
find two different plants that show the same mutant phenotype. You then use a complementation
test. What is the predicted outcome of this test if both phenotypes are caused by mutations in
separate genes?
recover the wild type phenotype
overexpress the gene
O recover the mutant phenotype
In roses, the synthesis of red pigment is produced by two steps in a pathway.
gene O
magenta intermediate -
gene P
colorless intermediate-
red pigment
What would the phenotype be of a plant homozygous for a null mutation of gene P?
What would the phenotype be of a plant homozygous for a null mutation of gene Q?
What would the phenotype be of a plant homozygous for null mutations of genes P and Q?
magenta
red
Match a genotype to each strain.
colorless
Strain
P locus Q locus
homozygous null mutation of gene P
homozygous null mutation of gene Q
homozygous null mutations of genes P and Q
Answer Bank
plp
PIP
What F2 ratio is expected from crossing a plant that is homozygous for a null mutation of gene P with a plant that is
homozygous for a null mutation of gene Q? Assume independent assortment.
9 colorless : 4 magenta : 3 red
9 red : 4 colorless : 3 magenta
O 9 red : 4 magenta : 3 colorless
Chapter 10 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 10 - Gene expression does not vary by ________. a. cell...Ch. 10 - Binding of _______ to _______ in DNA can increase...Ch. 10 - Prob. 3SACh. 10 - Mechanisms that govern gene expression do not...Ch. 10 - Muscle cells differ from bone cells because they...Ch. 10 - Prob. 6SACh. 10 - Prob. 7SACh. 10 - Prob. 8SACh. 10 - Which of the following includes all of the others?...Ch. 10 - Prob. 10SA
Ch. 10 - Prob. 11SACh. 10 - Prob. 12SACh. 10 - Prob. 13SACh. 10 - True or false? Gene expression patterns can be...Ch. 10 - Match the terms with the most suitable...Ch. 10 - Why are some genes expressed and some not?Ch. 10 - Do the same mechanism of governing gene expression...Ch. 10 - Prob. 3CTCh. 10 - The photos below show flowers from two Arabidopsis...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain how (a) the absence of class B gene expression produces the flower structures seen in class B mutants (see Figure 22.15c) and (b) the absence of class C gene expression produces the structures seen in class C mutants (see Figure 22.15d).arrow_forwardIn the module, you have learned about P-element mediated transgenesis in Drosophila and the concept of using transgenes to rescue mutant phenotypes. In the figure below, you will see a wild type fly with its natural eye colour and three mutants with their eye colours changed to vermillion, white and rosy, respectively. A schematic of P-element mediated transgenesis (as shown in the lectures) is also included in the figure. Please inspect the schematic carefully and choose which of the following statements is true: I. Injection of the white experimental transgene into the vermillion mutant embryo will not change the vermillion mutant phenotype II. Injection of the white experimental transgene in the rosy mutant embryo will change rosy eye colour to red (wild type) III. Injection of the white experimental transgene in the white mutant embryo will not change the white mutant phenotype IV. Injection of the white experimental transgene in the rosy mutant…arrow_forwardYou are a developmental geneticist studying flowering time variation in Arabidopsis. You perform a mutagenesis screen to identify mutants in the photoperiod pathway. Given what you know about photoperiodism in Arabidopsis, what phenotype are you looking for and under what photoperiodic conditions would you perform the experiment? delayed flowering in long days delayed flowering in short days same flowering in short days early flowering in short days same flowering in long days early flowering in long daysarrow_forward
- Cx is a member of the family of connexin genes that encode the proteins of gap junction intercellular channels. Cx proteins in one cell form hemi-channels in the plasma membrane. Hemi-channels in adjacent cells dock to form complete intercellular channels through which ions and small molecules diffuse from cell to cell. Distinct Cx mutations were identified in three different families, F1, F2 and F3, affected by the same disease. To study their functional properties, normal (wild type, wt) and mutant (m) Cx proteins were expressed in cultured cells. Translation of the proteins was checked (Fig. 3). A extracellular EC 1 SM TM 1 membrane 2 3 4 F10 intracellular N F2 EC 2 F3 oricand c B 42 kDa C 42 kDa 35 kDa Control wt m-F1 m-F2 PM C PM C PM C PM C Western blot anti-Cx Control wt PM C m-F1 PM C PM C = Metabolically labelled m-F2 PM C m-F3 PM C m-F3 PM C WSEY Fig. 3 mont (A). Membrane topology of Cx protein indicating positions of mutations. Cx is an integral membrane protein with 4…arrow_forwardThe sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein (GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the GFP signal to be higher, lower or same for mutant promoters. Mutn 1 (enter higher, lower or same) Mutn 2 (enter higher, lower or same) - 42 ? ? +1 Lac CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA Lac Mutl Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAarrow_forwardThe genes described below are part of the yeast mating signal transduction pathway that signals the presence of extracellular alpha pheromone to the nucleus. These genes are listed in the order they function in the pathway. STE3 encodes alpha pheromone receptor STE4 encodes the ß subunit of a heterotrimeric G protein STE7 encodes a protein kinase STE12 encodes a transcription factor Loss-of function-mutations in any of these genes are sterile. In addition, gain-of-function mutations can be isolated in these genes. For which gene would a loss of function mutation suppress gain-of-function mutations in any of the other three genes. STE3 STE7 STE12 STE4arrow_forward
- The genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forwardYeast cells are grown with galactose as the sole carbon source and ATP levels are abundant. Describe and diagram how GAL1 gene expression will be changed (or unchanged) in 1) a ΔGal3 mutant and 2) a ΔGal4 mutant in comparison to WT. (Δ is a symbol for deletion.) WT: ΔGal3: ΔGal4:arrow_forwardBoll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (TO-34) containing one copy of crylla detected by Southern blot. Protein was expressed in high concentration at 45 davs after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A…arrow_forward
- In Arabidopsis, it is well-known that a pulse of full-spectrum light during the night (in an otherwise long night) will induce flowering. This suggests that plants measure the length of night, and not the length of day. If the pulse of light during the night was blue light instead of full spectrum light, what would be the flowering time response of a plant with a knockout in cry2 (relative to wild type in the same conditions)? Explain.arrow_forwardYou are working with a fly hair cell developmental system. This Notch/Delta-regulated system results in clusters of cells where the central one differentiates into a specialized hair cell. To better understand this system you have tagged the C-terminal cytoplasmic domain of Notch with GFP. You have done a forward genetic screen to look for mutants that have unusual phenotypes in this Notch system. The first one is a mutation in Notch itself. This mutant is in the ADAM10 cleavage site and blocks proteolysis. Draw the expected outcome for such a mutant: GFP localization and developmental outcome 24hr after differentiation. WT before differentiation WT 24 hours after differentiationarrow_forwardLet’s suppose a researcher was interested in the effects of mutationson the expression of a protein-encoding gene for a proteinthat is 472 amino acids in length. This protein is expressed in leafcells of Arabidopsis thaliana. It has a molecular mass of approximately56,640 Da. Make a drawing that shows the expected resultsof a Western blot using proteins isolated from the leaf cells thatwere obtained from the following plants:Lane 1. A plant homozygous for a nonmutant geneLane 2. A plant homozygous for a deletion that removes the promoterfor this geneLane 3. A heterozygous plant in which one gene is nonmutant andthe other gene has a mutation that introduces an early stop codon atcodon 112Lane 4. A plant homozygous for a mutation that introduces anearly stop codon at codon 112Lane 5. A plant homozygous for a mutation that changes codon108 from a phenylalanine codon into a leucine codonarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Embryology | Fertilization, Cleavage, Blastulation; Author: Ninja Nerd;https://www.youtube.com/watch?v=8-KF0rnhKTU;License: Standard YouTube License, CC-BY