Genetics: From Genes to Genomes, 5th edition
Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 10, Problem 39P

The human RefSeq of the entire first exon of a gene involved in Brugada syndrome (a cardiac disorder characterized by an abnormal electrocardiogram and an increased risk of sudden heart failure) is:

5′ CAACGCTTAGGATGTGCGGAGCCT 3′

The genomic DNA of four people (1–4), three of whom have the disorder, was subjected to single-molecule sequencing. The following sequences represent all those obtained from each person. Nucleotides different from the RefSeq are underlined.

Chapter 10, Problem 39P, The human RefSeq of the entire first exon of a gene involved in Brugada syndrome a cardiac disorder

a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the amino acid sequence of the encoded protein as possible, indicating the N-to-C polarity.
b. Are any of these individuals homozygotes? If so, which person and what allele?
c. Is the inheritance of Brugada syndrome among these individuals dominant or recessive?
d. Is Brugada syndrome associated with allelic heterogeneity?
e. Are any of these individuals compound heterozygotes?
f. Do the data show any evidence for locus heterogeneity?
g. Which person has normal heart function?
h. For each variant from the RefSeq, describe: (i) what the mutation does to the coding sequence; and (ii) whether the variation is a loss-of-function allele, a gain-of-function allele, or a wild-type allele.
i. For each variant, indicate which of the following terms apply: null, hypomorphic, hypermorphic, nonsense, frameshift, missense, silent, SNP, DIP, SSR, anonymous.
j. Is the function of this gene haploinsufficient? Explain.
Expert Solution
Check Mark
Summary Introduction

a.

To determine:

The amino acid sequence for the RefSeq obtained from individual 1.

Introduction:

The mutation is the change in the nucleotide sequence of the gene, which results in either the formation of a defective protein or no protein at all. The mutation can also alter the regulation of certain genes leading to their hyperactivity or hypoactivity. It is different from recombination where gametes from parents are interchanged to produce new zygotes.

Explanation of Solution

The amino acid sequence for the RefSeq data 5' CAACGCTTAGGATGTGCGGAGCCT 3' will be N-glutamine-arginine-leucine-glycine-cysteine-alanine-glutamic acid-proline-C. The amino acid sequence for 5' CAACGCTTAGGATGTGCGGAGACT 3' is N-glutamine-arginine-leucine-glycine-cysteine-alanine-glutamic acid-threonine-C. The amino acid makes up large polypeptide chains that fold into functional proteins and perform different activities in the body of living organisms.

Expert Solution
Check Mark
Summary Introduction

b.

To determine:

The presence of the homozygous individual.

Introduction:

The genes are the sequence of nucleotides that are present on the chromosomes and encode for a specific protein that plays a crucial role in the functioning of the different processes in an organism. The gene is located at specific gene loci and can be structural or regulatory in nature.

Explanation of Solution

The individual 2 is homozygous as the two strands of genetic material in the individual is same, and for all other individuals, the composition of nucleotides on both the strands is different. So, they are not homozygous for the given trait. The individual 2 has a nucleotide sequence 5' CAACGCTTAGGATGTGAGGAGCCT 3'. It implies that both the strands have similar nucleotide sequence. However, the homozygous allele cannot be predicted through the nucleotide sequence of the individual.

Expert Solution
Check Mark
Summary Introduction

c.

To determine:

The inheritance pattern of Brugada syndrome among individuals.

Introduction:

The proteins are made of amino acids. The amino acids are of 20 types that combine in a varied manner to form proteins. The amino acids join together by peptide bonds. Proteins act as major substrates and reactants for the metabolic pathways. All the enzymes in the body that are crucial for the biochemical reactions are proteins.

Explanation of Solution

The inheritance of the disease, Brugada syndrome, is dominant as the disease develops by the inheritance of particular nucleotide sequence 5′ CAACGCTTAGGATGTGCGGAGCCT 3′ that is inherited by three organisms and has very little variation in the sequence structure due to mutation. The sequence is present in individual 1, 3, and 4, and accounts for the development of the disease when only one strand of the exon contains the sequence. So, implying that one copy is enough to cause the disease and therefore, the inheritance of the Brugada syndrome is dominant.

Expert Solution
Check Mark
Summary Introduction

d.

To determine:

The association of Brugada syndrome with allelic heterogeneity.

Introduction:

The cardiovascular system is made of different components. The heart constitutes the primary organs of the system, and the arteries, veins, and blood capillaries form the associated structures of the cardiovascular system.

Explanation of Solution

Brugada syndrome is associated with allelic heterogeneity as the presence of only one copy of the sequence or allele in the exon can lead to the development of the disease. It implies that the disease can occur in heterozygous condition, where only one copy of allele is enough to cause disease. Hence, it can be concluded that Brugada syndrome is associated with allelic heterogeneity.

Expert Solution
Check Mark
Summary Introduction

e.

To determine:

The presence of compound heterozygotes among individuals.

Introduction:

A genetic disorder is an alteration in the genetic composition of the individual for one or more genes that are manifested in the form of altered protein sequence for that particular trait. The genetic disorder is phenotypically manifested in various forms of abnormalities and malfunctions.

Explanation of Solution

Compound heterozygotes are the individuals who have two different mutations occurring in the two alleles of an individual. None of the individuals are compound heterozygotes, as only one of the copies of exon/allele is affected by mutation at a given time. The presence of only one mutation in one of the allele is a heterozygous condition. Hence, individuals 1, 3, and 4 are heterozygous, but not compound heterozygous.

Expert Solution
Check Mark
Summary Introduction

f.

To determine:

The presence of locus heterogeneity among individuals.

Introduction:

The human consists of 23 pairs of chromosomes, condensed form of chromatids which divide during cell division into daughter cells. The human has 22 autosomes and one pair of sex chromosomes. The sex chromosomes determine the sex in an individual based on the type of sex chromosomes that are present in the fusing gametes.

Explanation of Solution

Locus heterogeneity is the condition where two different kinds of mutation occur at a different locus in the same chromosomes. None of the individuals has locus heterogeneity as all the individuals have only one mutation at one site or locus in the chromosome. Hence, none of the individuals shows locus heterogeneity.

Expert Solution
Check Mark
Summary Introduction

g.

To determine:

The individual with normal heart function.

Introduction:

The chromosomes are condensed structures that are formed during the early phases of cell division from the loose network of chromatin thread and then regain their original structure after being divided into daughter cells.

Explanation of Solution

The individual who does not have the Brugada syndrome is individual 2, as the nucleotide sequence of the individual varies from the person who is positive for the cardiac disorder. The individual has changed single nucleotide in both the alleles and is therefore homozygous in nature. The difference in the nucleotide sequence in both the alleles accounts for normal heart function in individual 2.

Expert Solution
Check Mark
Summary Introduction

h.

To determine:

The effect of the mutation on the coding sequence.

Introduction:

Fertilization is the process by which the male gamete, sperm, fertilize with the female gamete, ovary. The process brings about the fusion of two haploid pronuclei into a diploid zygote.

Explanation of Solution

The changes occurred due to a mutation in coding sequence are that in individual 1 there is a change in amino acid sequence as the amino acid proline is changed to threonine. In individual 2, the change in amino acid sequence occurs from alanine to glutamine. In individual 3, there is a change of amino acid sequence cysteine to alanine, and in individual 4, the amino acid changes from alanine to valine. The effect of this mutation as loss-of-function or gain-of-function can be done by protein expression analysis. The three individuals are not wild type due to the presence of the mutation.

Expert Solution
Check Mark
Summary Introduction

i.

To determine:

The type of mutation in the sequence.

Introduction:

There are a vast number of cardiovascular problems that can arise due to malformation in the heart or the dysfunction of some parts of the cardiovascular system. Some of these disorders are fibrillation, septal defects, and so on.

Explanation of Solution

The mutation in all the individuals is single nucleotide polymorphisms (SNPs) as there is a change only in one nucleotide and not the entire codon. The presence of silent, missense, or nonsense mutation can only be done with the help of protein expression analysis through techniques like microarray and so on.

Expert Solution
Check Mark
Summary Introduction

j.

To determine:

The presence of gene haploinsufficiency in the function.

Introduction:

The circulatory system and cardiovascular systems form the two very important different organ systems in the body. The system is responsible for pumping the blood carrying nutrients and oxygen and helping to remove waste products from the body.

Explanation of Solution

Gene haploinsufficiency is the condition in which normal phenotype needs the protein to encode by both the alleles, and there is a reduction in the function by 50% if any one of the alleles has the abnormal phenotype. The presence of a mutation in the genome of all the individual increases the probability of gene haploinsufficiency. The change in the phenotype of the alleles of the exon due to mutation can account for gene haploinsufficiency in the individuals.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!
Students have asked these similar questions
For the following sequence please design an 18 base pair forward primer.  ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAG
What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?

Chapter 10 Solutions

Genetics: From Genes to Genomes, 5th edition

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License