Concept explainers
Introduction:
Genes are a functional unit of heredity. They are passed on from parent generation to the progenies. Genes consist of DNA sequences that pass on specific information regarding cellular functioning. Genes are responsible for the synthesis of different types of proteins that perform the required function in the body.
Answer to Problem 1SQ
Correct answer:
The expression of a gene may depend on the type of organism, environmental conditions, and the type of cell. Hence, the correct answer is option d.
Explanation of Solution
Reason for correct answer:
Option d. is given as “all of the above.”
Gene expression depends on the type of organism. Some genes (such as insulin coding genes) are active in only a few animal species. Specific types of cells secrete certain proteins. Some of the hormonal proteins are secreted under specific environmental conditions. Gene expression depends on various factors, such as the type of organism, cell type, and environmental conditions.
Reason for incorrect answer:
Option a. is given as, “the type of organism.”
Not all the genes are expressed in all the organisms. Expression of genes depends on the type of organisms. Along with this, certain specific genes are expressed only in specialized cells. This makes the expression of genes dependent on the type of cell as well. Hence, option a. is incorrect.
Option b. is given as, “environmental conditions.”
Genes coding for certain hormonal proteins are expressed under specific environmental conditions. Not all the hormones are secreted in all species. This also makes gene expression dependent on the type of organism. Hence, option b. is incorrect.
Option c. is given as, “type of cell.”
Some genes are secreted in specific types of cells, for example, oncogenes are active only in tumor cells. Under certain environmental conditions, also, particular genes are activated. Hence, option c. is incorrect.
Hence, the options a., b., and c. are incorrect.
The type of organism, environmental conditions, and the type of cell, all determines the expression of a gene in an organism. Thus, the correct option is d.
Want to see more full solutions like this?
Chapter 10 Solutions
EBK BIOLOGY: CONCEPTS AND APPLICATIONS
- 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making multiple copies of an mRNA molecule after it has been transcribed from DNA B. Converts a protein sequence to mRNAarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forwardWhich of the following statament is NOT TRUE about gene expression?a. The expression of genes that code for proteins includes two stages: replication and translationb. Translation is the synthesis of a polypeptide using the information in the mRNA.c. During gene expression, the information encoded in genes is used to make specific polypeptide chains or RNA molecules.d. Gene expression is the process by which DNA directs the synthesis of proteinsarrow_forward
- DNA methylation is A. heritable and generally activates gene expression. B. heritable and generally represses gene expression. C. not heritable and generally represses gene expression. D. not heritable and generally activates gene expression.arrow_forward1. A neuron and a white cell have very different functions. For example, a neuron can receive and respond to electrical signals while a white cell defends the body because it ___________.to. the proteins in neurons are completely different from those in the white cell.b. neurons and white cells in an individual have the same genome.c. the neuron expresses some mRNAs that the white cell does not express.d. Both neurons and white cells are already differentiated cells that do not need to transcribe or translate genes. 2. Which of the following is the main reason for a typical eukaryotic gene to be able to respond to a greater variety of regulatory signals than a typical prokaryotic gene or operon?to. eukaryotes have three types of RNA polymeraseb. RNA polymerases in eukaryotes require general and unspecific transcription factorsc. the transcription of a gened. prokaryotic genes are packed in nucleosomes 3. The distinctive characteristics of different types of cells in a multicellular…arrow_forwardOperons______ . a. only occur in bacteria b. include multiple genes c. involve selective gene expressionarrow_forward
- In general, all mutations can be considered harmful, because most genetic systems are already optimized to work correctly and efficiently. A. True b. False; mutations are considered harmful only if they have a direct effect on the ability of cells to synthesize DNA c. False; some mutations are harmful, and some are considered beneficialarrow_forwardDuring transcription, ___________________. a. A cell divides to make 2 new cells b. A cell divides to make 4 new cells c. DNA is used as a template to create mRNA d. mRNA, rRNA, and tRNA work together to make proteinsarrow_forwardWhich of the following statements about genes is incorrect? Select one: O a. During fertilization, both the sperm and the ovum contribute genes to the resulting fertilized egg. b. Genetic differences can result from changes in the DNA called mutations. O c. Genes correspond to segments of DNA. d. Under normal circumstances, each chromosome contains precisely one gene. e. Many genes contain the information needed for cells to synthesize enzymes and other proteins.arrow_forward
- Mechanisms that govern gene expression do not operate during______ . a. transcription c. translation b. RNA processing d. knockoutsarrow_forwardMuscle cells differ from bone cells because they_______ . a. carry different genes c. are eukaryotic b. express different genes d. are different agesarrow_forwardAt birth a child has got blue eyes, but now his/her eyes turn brown. Which of the following statements would best explain the observed phenomena? A. The child does not have brown pigment at birth B. Eye’s colour at birth is affected by mother’s gene C. Gene repressor for brown pigment produced is not yet active D. Gene activatior for brown pigment production is not yet active at birth E. All of the above statements are falsearrow_forward