Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
12th Edition
ISBN: 9780134605203
Author: Ted R. Johnson, Christine L. Case
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Textbook Question
Chapter 10, Problem 1CT
Using Bergey’s Manual and your text, place the following genera in this flowchart
- Bacillus
- Escherichia
- Neisseria
- Staphylococcus
- Corynebacterium
- Mycobacterium
- Sporosarcina
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Match the following genera correctly with the correct characteristic, role, or disease.
Vibrio
Lactobacillus
Streptococcus
Leucothrix
Escherichia
Clostridium
Nitrosomonas
Rickettsia
Legionella
Choose one for each :
Infect other bacteria
Can cause severe food poisoning, especially from improperly canned food
Strep throat
Normally an important gut microbe but not a probiotic
HIV
MRSA
Typhus
Whooping cough
Legionnaire's disease
Disperse by gonidia
Produce antibiotics
Bioluminescent
Probiotic
Important in nitrogen cycle
Tetanus
Bacteria:
alcaligenes faecalis
bacillus megatorium
bacillus subtilis
citrobacter freundii
corynebacterium xerosis
edwardsiella tarda
enterobacter aerogenes
enterobacter cloacae
klebsiella pneumoniae
kocuria rosea
lactobacillus casei
morganello morganii
proteus mirabilis
proteus hauseri
providencia rettgeri
providencia stuartii
psuedomonas fluorescens
salmonella enteriditis
question: organize the above bacteria into the correct types of bacteria according to the gram stain (gram positive cocci, gram positive bacilli, or gram negative bacilli).
Which of the following bacteria is the most common isolate from blood?
Vibrio cholerae
Mycobactererium tuberculosis
Mycoplasmapneumoniae
Helicobacter pylori
Escherichia coli
Which of the following bacteria often cause Otitis media (middle ear infections) in children?
Mycoplasma pneumoniae
Mycobactererium tuberculosis
Streptococcuspneumoniae
Helicobacter pylori
Escherichia coli
Which of the following influenza viruses is/are influenza B virus(es)?
H1N1
H3N2
H7N9
All of the above
None of the above
Chapter 10 Solutions
Laboratory Experiments in Microbiology (12th Edition) (What's New in Microbiology)
Ch. 10 - Which two stains done in this experiment are...Ch. 10 - Do all bacteria make endospores?Ch. 10 - What is the Gram reaction of acid-fast bacteria?Ch. 10 - Using Bergeys Manual and your text, place the...Ch. 10 - Which genera listed in the previous question...Ch. 10 - Assume you have performed a Gram stain on a sample...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTarrow_forwardGive the distinctive characteristics of the following: Mycobacterium Escherichia Micrococcusarrow_forwardWhat is the morphology of the following cells: streptococci diplobacilli diplococci streptobacilliarrow_forward
- Description Shape: Arrangement: Photo by 1000x MITPanganiban Figure 2.9. Microscopic morphology of Bacillus cereus. Description Shape: Arrangement: Photo by 1000x MITPanganiban Figure 2.10. Microscopic morphology of Staphylococcus aureus..arrow_forwardNeisseria lactamicaPseudomonas aeruginosaPseudomonas fluorescensPseudomonas putidaAlcaligenes faecalisAlcaligenes latusAeromonas sobriaEnterobacter aerogenesEnterobacter cloacaeSerratia marcescansSerratia rubidaeaSerratia liquefaciensEscherichia coliKlebsiella pneumoniaeKlebsiella oxytocaMorganella morganiiSalmonella enterica serogroup enteriditisShigella flexneriProteus vulgarisProteus mirabilis some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to first eliminate a set from your possibilities (look them up to figure this out). Eliminate the organisms that *cannot* do something your organism *can*. This means you have a positive test result and you eliminate those that are always negative for that result. At first eliminate the organisms that *cannot* do something your organism *can*. This means you have a positive test result and you eliminate those that are always negative for that result. That way you do not have to worry that you…arrow_forwardNeisseria lactamicaPseudomonas aeruginosaPseudomonas fluorescensPseudomonas putidaAlcaligenes faecalisAlcaligenes latusAeromonas sobriaEnterobacter aerogenesEnterobacter cloacaeSerratia marcescansSerratia rubidaeaSerratia liquefaciensEscherichia coliKlebsiella pneumoniaeKlebsiella oxytocaMorganella morganiiSalmonella enterica serogroup enteriditisShigella flexneriProteus vulgarisProteus mirabilis unknown 14 gram negative organism some of the above choices are strict aerobes and some are facultative anaerobes and process the elimination. When a particular organism has been eliminated from the list to a test result to find the identified organism. This is helpful to first eliminate a set from your possibilities (look them up to figure this out). Eliminate the organisms that *cannot* do something your organism *can*. This means you have a positive test result and you eliminate those that are always negative for that result. At first eliminate the organisms that *cannot* do something your…arrow_forward
- Neisseria lactamicaPseudomonas aeruginosaPseudomonas fluorescensPseudomonas putidaAlcaligenes faecalisAlcaligenes latusAeromonas sobriaEnterobacter aerogenesEnterobacter cloacaeSerratia marcescansSerratia rubidaeaSerratia liquefaciensEscherichia coliKlebsiella pneumoniaeKlebsiella oxytocaMorganella morganiiSalmonella enterica serogroup enteriditisShigella flexneriProteus vulgarisProteus mirabilis some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to first eliminate a set from your possibilities (look them up to figure this out). Eliminate the organisms that *cannot* do something your organism *can*. This means you have a positive test result and you eliminate those that are always negative for that result.arrow_forwardNeisseria lactamicaPseudomonas aeruginosaPseudomonas fluorescensPseudomonas putidaAlcaligenes faecalisAlcaligenes latusAeromonas sobriaEnterobacter aerogenesEnterobacter cloacaeSerratia marcescansSerratia rubidaeaSerratia liquefaciensEscherichia coliKlebsiella pneumoniaeKlebsiella oxytocaMorganella morganiiSalmonella enterica serogroup enteriditisShigella flexneriProteus vulgarisProteus mirabilis some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to first eliminate a set from your possibilities (look them up to figure this out)arrow_forwardNeisseria lactamicaPseudomonas aeruginosaPseudomonas fluorescensPseudomonas putidaAlcaligenes faecalisAlcaligenes latusAeromonas sobriaEnterobacter aerogenesEnterobacter cloacaeSerratia marcescansSerratia rubidaeaSerratia liquefaciensEscherichia coliKlebsiella pneumoniaeKlebsiella oxytocaMorganella morganiiSalmonella enterica serogroup enteriditisShigella flexneriProteus vulgarisProteus mirabilis some of the above choices are strict aerobes and some are facultative anaerobes. This is helpful to first eliminate a set from your possibilities (look them up to figure this out eliminate the organisms that *cannot* do something your organism *can*. This means you have a positive test result and you eliminate those that are always negative for that result. That way you do not have to worry that you accidentally killed the unknown before you inoculated it. You Do still need to be concerned that you interpreted the test results correctly and did not introduce a contaminant that has the ability…arrow_forward
- Which of the following has the greatest clinical impact? What and how will you eradicate this parasitic infection? describe your methods for elimination. Balantidium coli Trypanosoma cruzi Trypanosoma brucei . Leishmania Giardia Trichomonas Plasmodium Toxoplasma . Cryptosporidium . Cyclospora . Taenia Echinococcus Ascaris lumbricoidesarrow_forwardWhat type shape is this bacteria exhibiting? streptococci spirilla staphylococci staphlobacilliarrow_forwardComplete the table below and provide a detailed description of the morphological characteristics and unique features of every microorganism. Classification of Microorganism Name of Microorganism Morphological Characteristics Unique features (habitat, metabolites, structures, etc.) Bacteria 1 Escherichia coli Bacteria 2 Klebsiella pneumoniae Fungi 1 Emericella stellamaris Fungi 2 Aspergillus oryzae Protozoa 1 Green algae (zoochlorellae) Protozoa 2 amoeba (Korotnevella spec.) Virus Bacteriophagesarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Bacterial Infections in Humans; Author: Professor Dave Explains;https://www.youtube.com/watch?v=FeFKAl9KyMg;License: Standard Youtube License