Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
3rd Edition
ISBN: 9780134807799
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 1, Problem 19P
A portion of a polypeptide contains the amino acids Trp-Lys-Met-Ala-Val. Write the possible mRNA and template strand DNA sequences. (Hint: Use A/G and T/C to indicate that either adenine/guanine or thymine/cytosine could occur in particular position, and use N to indicate that any DNA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the following wild-type double-stranded DNA sequence:
5' TATGAA AGT3
non-transcribed strand (sense strand)
5'
3' ATACTTTCA
transcribed strand
In the space below, write ONE of the possible DNA sequences of the transcribed
strand shown above that results from BOTH a single substitution mutation of the
first codon following the start codon that would also cause a nonsense mutation.
Use the mRNA codon chart in the Appendix of your manual to help you.
Answer:
Check
Below is a polinucleotide sequence of the non-template strand of a coding DNA sequence. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein.
Example: (USE SPACES BETWEEN CODONS): ' XXX XXX XXX XXX '
Example: (USE SPACES BETWEEN AMINOACIDS): Polypeptide: direction-XXX-XXX-XXX-direction
ATG GCA TGC AAT AGC TCA TGC
b) What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A? (3
For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases:
AGCTAATCGGCTACCAGGTACGGATATTCC
Chapter 1 Solutions
Genetic Analysis: An Integrated Approach Plus Mastering Genetics with Pearson eText -- Access Card Package (3rd Edition) (What's New in Genetics)
Ch. 1 - 1. Genetics affects many aspects of our lives....Ch. 1 - 2. How do you think the determination that DNA is...Ch. 1 - 3. A commentator once described genetics as “the...Ch. 1 - All life shares DNA as the hereditary material....Ch. 1 - Define the terms allele, chromosome, and gene and...Ch. 1 - 6. Define the terms genotype and phenotype, and...Ch. 1 - 7. Define natural selection, and describe how...Ch. 1 - Describe the modern synthesis of evolution, and...Ch. 1 - What are the four processes of evolution? Briefly...Ch. 1 - Define each of the following terms: a....
Ch. 1 - 11. Compare and contrast the genome, the proteome,...Ch. 1 - With respect to transcription describe the...Ch. 1 - Plant agriculture and animal domestication...Ch. 1 - Briefly describe the contribution each of the...Ch. 1 - If thymine makes up 21% of the DNA nucleotides in...Ch. 1 - What reactive chemical groups are found at the 5...Ch. 1 - Identify two differences in chemical composition...Ch. 1 - What is the central dogma of molecular biology?...Ch. 1 - A portion of a polypeptide contains the amino...Ch. 1 - The following segment of DNA is the template...Ch. 1 - 23. Fill in the missing nucleotides (so there are...Ch. 1 - 24. Suppose a genotype for a protein-producing...Ch. 1 - Prob. 25PCh. 1 - 26. Four nucleic acid samples are analyzed to...Ch. 1 - 27. What is meant by the term homology? How is...Ch. 1 - 28. If one is constructing a phylogeny of reptiles...Ch. 1 - 29. Consider the following segment of...Ch. 1 - 30. Ethical and social issues have become a large...Ch. 1 - 31. In certain cases, genetic testing can identify...Ch. 1 - 32. What information presented in this chapter and...Ch. 1 - 33. It is common to study the biology and genetics...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forwardA strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forwardUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.arrow_forward
- Help me pleasearrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forward
- Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA (anticodon) UAG TAG Amino acid coded into proteins CAT CAU GUC CCA ATG Methionine (Met) Valline (Val) GUU, GUC, GUA, GUG ACU ACA UGU AAA AAA GAA CuU Procedure: Refer to the Genetic Code Table below to identify the right amino acid coded. To determine the order of bases in the first column (UNA), second column (codon) and the third column Is the anticodon. Consider the complementary base pair, in DNA and in RNA To identify the amino acid, took at the bases in the MRNA codon, example AUG using the Genetic Code Table. Loo: for the first letter of the MRNA codon on the left side of the genstis code table (A), the second letter of the MRNA on the second letter column (U), and the third letter on the right-side column (G). AUG codes for the amino acid -methionine. Do the same with the other codons in the chart. Genetic Code Table and posticn of codon Cystelne Cysteine UAU TyrY UAC Tyr Y Tyrosine USA UAG CAU His H…arrow_forwardConsider the following DNA sequence, which codes for a short polypeptide: 5'-ATGGGCTTAGCGTAGGTTAGT-3' Determine the mRNA transcript of this sequence. You have to write these sequences from the 5' end to the 3' end and indicate those ends as shown in the original sequence in order to get the full mark. How many amino acids will make up this polypeptide? Determine the first four anticodons that will be used in order to translate this sequence.arrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forward
- A polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Glarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 2: Met-Ser-Proarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Glyarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY