Genetic Analysis: An Integrated Approach (2nd Edition)
2nd Edition
ISBN: 9780321948908
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 1, Problem 12P
With respect to transcription describe the relationship and sequence correspondence of the RNA transcript and the DNA template strand. Describe the relationship and sequence correspondence of the mRNA transcript to the DNA coding strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Describe the steps necessary to synthesize mRNA fromeach of the following: double-stranded DNA, singlestranded (1)DNA, single-stranded (2)DNA, singlestranded (1)RNA, and single-stranded (2)RNA.
Define both transcription and translation. In addition, describe the role(s) of each of the following in the processes of gene expression and protein synthesis: DNA, mRNA, tRNA, rRNA, ribosome(s), RNA polymerase, codon, anticodon, amino acid(s) and polypeptide(s). Be detailed in your answer.
Given the following DNA sequence of the template strand for a given gene:
5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'
Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).
Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.
Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Chapter 1 Solutions
Genetic Analysis: An Integrated Approach (2nd Edition)
Ch. 1 - 1. Genetics affects many aspects of our lives....Ch. 1 - 2. How do you think the determination that DNA is...Ch. 1 - 3. A commentator once described genetics as “the...Ch. 1 - All life shares DNA as the hereditary material....Ch. 1 - Define the terms allele, chromosome, and gene and...Ch. 1 - 6. Define the terms genotype and phenotype, and...Ch. 1 - 7. Define natural selection, and describe how...Ch. 1 - Describe the modern synthesis of evolution, and...Ch. 1 - What are the four processes of evolution? Briefly...Ch. 1 - Define each of the following terms: a....
Ch. 1 - 11. Compare and contrast the genome, the proteome,...Ch. 1 - With respect to transcription describe the...Ch. 1 - If thymine makes up 21% of the DNA nucleotides in...Ch. 1 - What reactive chemical groups are found at the 5...Ch. 1 - Identify two differences in chemical composition...Ch. 1 - What is the central dogma of molecular biology?...Ch. 1 - A portion of a polypeptide contains the amino...Ch. 1 - The following segment of DNA is the template...Ch. 1 - 29. Consider the following segment of...Ch. 1 - 23. Fill in the missing nucleotides (so there are...Ch. 1 - 26. Four nucleic acid samples are analyzed to...Ch. 1 - 23. Are seed-eating finches among Darwin’s finches...Ch. 1 - 28. If one is constructing a phylogeny of reptiles...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 5. a) Describe, using a diagram or point form notes, what is happening during transcription and translation of protein synthesis. Indicate where these events take place in the cell. b) An error occurs in the transcription of the original master strand of DNA. At the very first base pair, a guanine is substituted for cytosine. State the possible effects on the polypeptide and its functions.arrow_forwardFor a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?arrow_forwardRefer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)arrow_forward
- Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’arrow_forwardIn relation to central dogma of molecular biology answer the following questions: The following segment of DNA is part of the transcription unit of a gene. You know already that RNA polymerase moves in a specific direction along this piece of DNA to convert one of the DNA strands into a single strand RNA transcript so that this entire region of DNA is made into RNA. 5′-GGCATGGCAATATTGTAGTA-3′ 3′-CCGTACCGTTATAACATCAT-5′ Given this information, a student claims that the RNA produced from this DNA is: 3′-GGCATGGCAATATTGTAGTA-5′ Give two reasons why this answer is incorrect.arrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
- Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:arrow_forwardDescribe the packaging of chromosomal DNA by histones with diagrammatic representations. Name the various histone modifications and describe any two among them.arrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forward
- Eukaryotic Genetic Sequence: 5'-TAC CAT GAT CCC TAT - 3' 1. What would be the newly synthesized DNA strand and explain how the strand will be replicated. Where in the cell would this occur? 2. What would be the synthesized mRNA strand, and how is it transcribed from the original DNA strand, and then converted from a pre-mRNA strand to a mature mRNA? Where in the cell does this occur? 3. What would be the anti-codons for the tRNA. What are the amino acids generated based on the RNA. How are these amino acids translated into protein and where in the cell does this happen?arrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardDefine Overlapping code as they apply to the genetic codearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY