write a Java program , to write data into a file ( output.txt ). The output.txt file is below. 1 22 333 4444 55555 666666
Q: Write a Java program that allows the user to specify a file name on the command line and prints the…
A: The program for the above problem is given below:
Q: 1. Write a java program that will add all the "Composite Numbers" found in a "Comma Separated" file.…
A: ALGORITHM:- 1. Create the file and insert data in it. 2. Read the file and calculate the sum of…
Q: Implement a system of three processes which read and write sequence numbers to a file.
A: ANSWER:
Q: Write a program to make a file D: \example.dat file using BinaryWriter class, store current date and…
A: BinaryWriter class BinaryWriter class writes Primitive type data type like int, unit, or char in…
Q: Write a Python program that reads each line of an input file temperatures.txt that consists of a…
A: Algorithm : Step 1 : opening the file temperature.txt in read mode and tempSummary.txt in write…
Q: Write a python program that reads from a text file whose name is provided by the user and including…
A: Program plan: Read and check for the input file Check for the input content of the file and…
Q: Write a Python program to count the number of lines in a text file. Then, finally print the total…
A: len is used to find the length of iterable readlines() method will return us the contents in file as…
Q: Write a program that opens a file me.txt and write your first name followed by a space followed by…
A: The program has been written in python language.
Q: Write a Python program that reads each line of an input file temperatures.txt that consists of a…
A: def main():try: temp_Writer = open("tempSummary.txt",'w'); print("Reading file temperatures")…
Q: Using the Java compiler, try to create a file in the same directory and take the name of file from…
A: Java Code will first read the destination of file to be saved from test.txt file and save the…
Q: Write a java program to read from the Keyboard name of the item and its price until the user Enter…
A: Step 1 : Start Step 2 : In the main method , declare the array of strings to store the item names…
Q: Write a C program that takes a file as input, reads each line, and prints out he numbers of c's in…
A: C Program to print out the numbers of c's in a file: #include <stdio.h>#include…
Q: 3. Write a java program that will parse the 13th digits Student ID only from a file. Student ID…
A: Below is the complete solution with sample Program and Output Images in detail for the given…
Q: Using Java, Write a program that reads an input file and writes an output file inserted using…
A: Here I written Java Code with File I/O for given problem below. I hope you like it.
Q: 1. Write a Java Program to Reverse the Contents of a File and Print it (Use EilelnputStream and…
A: For this program, the following steps need to be taken: Reading file using FileInputStream and…
Q: Write a Java Program to perform the following operations using FileOutputStream and FileInputStream…
A: Note: This code should be rewritten instead of copying to the compiler otherwise it will throw a…
Q: Write a program that removes all the occurrences of a specified string from a text file. For…
A: This program is done with java file operations. So initially reading the file arguments from the…
Q: Write a program which reads from a file all digits and prints the largest number which is a multiple…
A: Include header files In main() declare the variables arr, count, largest , n, and line Create a…
Q: Write a C program that will get 10 grades of the student from a file. Get the average of the three…
A: #include <stdio.h> #define SIZE 1024 int main() { char text[SIZE]={0},record[100];…
Q: Write a Java code that reads an input file and display the sum and the average. (submit the code and…
A: Here I have used the Scanner class object to read the file having data. Next, I have used a while…
Q: write a Java program to find the longest word in a text file then display that word and write it to…
A: Algorithm: Start READ fileName Open fileName in reading mode Scan the file and find the longest…
Q: Modify the Total program so that it shows the average, not the total of the inputs. Total.java 1…
A: A modified “Total” program is as follows, File name: “Total.java” import java.io.File; import…
Q: Write a Python program that reads from each line of an input file called grades.txt, a student id…
A: Python code for Take three subject marks Return average with name or roll number.
Q: Write a C++ program that reads data from a file containing integers that ends with -999 and Output…
A: The program is written in C++ #include<iostream> #include<stdlib.h>…
Q: Write a program which reads from a file all digits and prints the largest number which is a multiple…
A: A number is said to be a multiple or factor of a number if the number is divisible by the multiple…
Q: Modify the code to read file tooutfile2.txt, compute and display the total. Then write the total to…
A: The answer given as below:
Q: Write a Java program that does the following: 1. Read 10 integer values from a text file. a. The…
A: Answer:
Q: Write a Java Program to perform the following operations using FileOutputStream and FileInputStream…
A: Note: This code should be rewritten instead of copying to the compiler otherwise it will throw a…
Q: in javaWrite a program that generates 10 random doubles, all between 1 and 11, and writes them to a…
A: The class FileWriteDouble generates random numbers within the given limits and writes it to a text…
Q: Write a program that reads in from a file a starting month name, an ending month name, and then the…
A: #include <iostream>#include <string>#include <fstream>#include…
Q: Write a program in python language using basics that takes multiple student marks as input. If a…
A: Use an infinite loop to accept input from user and exit from loop if the user input marks is…
Q: Write a Python program that reads each line of an input file called data.txt that consists of a…
A: Algorithm: Start Read the content of data.txt file and store the content in data Open sorted.txt…
Q: Write a program that reads a file one character at a time and prints out how many characters are…
A: File name: “Characters.java” import java.io.File; import java.io.FileInputStream; import…
Q: Write a Python program that reads each line of an input file temperatures.txt that consists of a…
A: inputfile=open('temperatures.txt','r') #Opening the temperatures.txt…
Q: Is it true or false? The read position advances forwards, towards the end of the file, as things…
A: In any programming language, If you read a file in an sequential access means from start to end…
Q: Construct a Java program to provide a file named file.txt if it does not exist. Write 100 integers…
A: import java.io.*; import java.util.*; public class Random1 { public static void…
Q: Create a java program that search a specific word in a text file. Also, count how many times the…
A: CODE: //importing the necessary packages import java.io.FileReader;import java.io.IOException;import…
Q: 1 import java.io.File; 2 import java.util.Scanner; 3 import java.io.FileWriter; 4 import…
A: Solution: Save the Data.txt file in the same folder where you saved the Main.java file. Java…
Q: Write a python program that reads the first n lines of a text file. Suppose you have a file with all…
A: Here, Code instruction is given.
Q: Write a Python program that reads from each line of an input file called grades.txt, a student id…
A: Algorithm : Step 1 : opening the grades.txt file in read mode. Step 2 : opening the results.txt…
Q: Write a high-security program in C that reads positive integers from a file "/challenge/numbers.txt"…
A: In this question, we are asked to write a program in C to fetch the number from a file and output…
Q: . Write a Python program that takes a text file as input and returns the number of words of a given…
A: Required:
Q: Exercise 2: Write a Java program that allows the user to specify a file name on the command line and…
A: Overview: Counting the number of characters is important because almost all the text boxes that rely…
Q: Create a java program that takes in two strings as arguments- the source and destination filenames,…
A: The scanner is a java API class that is used to read data from either the keyboard or from the file.…
Q: Construct a Java program to provide a file named file.txt if it does not exist. Write 100 integers…
A: I give the code in Java along with output and code screenshot along with explanation
Q: Write a program that will countthe number of characters, words, and lines in a file. Words are…
A: import java.io.*; import java.util.*; public class Exercise12_13 { public static void…
Q: Please write a Java program , to write data into a file (output.txt). The output.txt file is below.…
A: Introduction Please write a Java program, to write the data into the file (output.txt). The…
Please write a Java
1
22
333
4444
55555
666666
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- 12 Digit Barcode In this homework, you will develop a python program which reads a series of barcodes from "barcodes.txt" and creates an output file "output.txt" which contains the barcodes and their status as seen in the example output below. 153182953420 5+1+2.5.4-1 7+3+8+4+3+2-3 1 23601057072 6+t-13 Even : 2+6+1 +5+0 = 14 Odd: 1+3+0+ 0 +7+7 = 18 3 x8 = 24 D+3- 10 4 + 4 = 8 10 -8 = 2 (CORRECT) What to submit: 1) ipynb file which contains checkBarcode function which takes a string varlable as input and returns true or false, and a driver program which reads in "barcodes.txt" and creates "output.txt". Assume the input file contains one barcode info per line. Important: Your input file name MUST BE "barcodes.txt" and the output file name MUST BE "output.txt". Otherwise, you'l get up to 30 pts penalty Below a sample output.txt: 123601057072 is a valid 10-digits barcode lab601057072 is an invalid 10-digits barcode 172601055072 is an invalid 10-digits barcode 12345 is an invalid 10-digits…Create methods "read" and "write" methods to handle the input and output to files. in JavaUsing Java: A hotel salesperson enters sales in a text file. Each line contains the following, separated by semicolons: the name of the client the service sold ( Dinner, Conference, Lodging) the amount of the sale the date of the event. Write a program that reads such a file and displays the total amount of each service category. Display an error if the file does not exist or the format is incorrect.
- PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonThe file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUsing Java PrintWriter, write a program that prompts the user for information and saves it to a text file File name is musicians.txt Use this information below: George,Thoroughgood,54321 Ludwig,Van Beethoven,90111 Edward,Van Halen,12345Java Problem The teacher at a school needs help grading an exam with a number of True/False questions. The students’ IDs and test answers are stored in a file. The first entry of the file contains the answer to the test in the form: TTFTFTTTFTFTFFTTFTTF Every other entry in the file is the student’s ID, followed by a blank, followed by the students’ response. For instance, the entry: ABC54102 T FTFTFTTTFTTFTTF TF The student’s ID is ABC54102, answer to question 1 is True, the answer to question 3 is False. Also, the student did not answer question 2 and question 18. The exam has 20 questions. Here is the grading policy: each correct answer is awarded two points, each wrong answer get -1 point, and no answer gets 0 point. Write a program that processes the test data. The output should be the student’s ID, followed by the answers, followed by the test score (total points), followed by the test grade. Assume the following grade scale will be used: 90%-100%, A; 80%-89.99%, B; 70%-79.99%,…
- Requested files: InClass02.java, input.txt Maximum number of files: 6 Create a simple java program that reads all the content in a .txt file, the user will enter the filename to be opened. In this case, the file will contain multiple lines of student details with each line containing a single student detail. Your task is to then create a student class that models the firstname, lastname, year of birth and gender of every student. The student class should further be able to assign every student created with a student number using a class variable[format is 2022000X, X is a number such as 1,2..] and be able to calculate the age of each student. Within the driver class add all the students read from file into an ArrayList and then print the first and last student in the list. You are additionally expected to deal with most common exceptions(See samples below) [HINT: DO NOT PROVIDE A PATH BUT RATHER ONLY OPEN THE FILE WITH RELATIVE PATH/FILENAME] Sample run 1: Enter filename:…<<Write in Java>> - Challenge 7 File encryption is the science of writing the contents of a file in a secret code. Your encryption program should work like a filter, reading the contents of one file, modifying the data into a code, and then writing the coded contents out to a second file. The second file will be a version of the first file, but written in a secret code. Although there are complex encryption techniques, you should come up with a simple one of your own. For example, you could read the first file one character at a time, and add 10 to the character code of each character before it is written to the second file. - Challenge 8 Write a program that decrypts the file produced by the program in Programming Challenge 7. The decryption program should read the contents of the coded file, restore the data to its original state, and write it to another fileWrite a java code that does the following: Opens a file named NumberList.txt, uses a loop to write the numbers 1 through 100 to the file, and then closes the file. Opens the NumberList.txt file and reads all of the numbers from the file and displays them, and then closes the file. Opens the NumberList.txt file and reads all of the numbers from the file, calculate the sum of these numbers and displays their total. Opens a file named NumberList.txt for writing, but does not erase the contents of the file if it already exists.