The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Use python
Q: Describe the key features and components of the macOS user interface, including the menu bar, Dock,…
A: The macOS user interface is renowned for its elegant design and user-friendly experience. Apple has…
Q: Assignment: Dice Rolling Program Objective: Create a Java program that rolls two dice and displays…
A: Step-1) First, creating a class for single die.Step-2) In this, simulate the rolling dice using…
Q: Compile and link testdydt.cpp into a program called testdydt. The program only needs to do the test…
A: In order to implement the given task in cpp, follow the steps mentioned in the algorithm provided in…
Q: Explain the concept of NAT (Network Address Translation) and its various forms (Static NAT, Dynamic…
A: In order to guarantee data integrity, dependability, and compatibility, network protocols are…
Q: Provide an overview of the functioning of SNMP (Simple Network Management Protocol) and its role in…
A: Administrators can monitor and control devices connected to networks using the commonly used SNMP,…
Q: Discuss the macOS file system hierarchy. What is the role of directories like /Applications,…
A: The macOS file system hierarchy is the organizational structure that governs how files and…
Q: What is DNS and how does it work in the context of network protocols?
A: DNS, or Domain Name System, serves as the backbone of the internet, translating human-readable…
Q: Dive into the technical architecture of macOS, including its Unix-based foundation and the use of…
A: macOS, Apple's operating system for its Macintosh computers, is renowned for its robust stability…
Q: Explore emerging technologies and trends in mouse control, such as haptic feedback, neural…
A: The administration and usage of a computer mouse, a pointing device used to connect with a graphical…
Q: How do mouse microswitches work, and why is their durability and actuation force important to users,…
A: Mouse microswitches are an essential component of computer mice and play a crucial role in…
Q: Explain the role of Internet Service Providers (ISPs) in connecting users to the Internet, and…
A: A business or organization that provides people, businesses, and other clients with Internet…
Q: How can advanced users utilize Terminal and shell commands in macOS for system administration and…
A: 1) Terminal is a command-line interface (CLI) application found in Unix-like operating systems,…
Q: Explain the significance of macOS file systems, such as HFS+ and APFS, in terms of data management…
A: macOS, Apple's operating system, has seen the evolution of its file systems over the years. Two…
Q: Discuss the various types of mouse grips (palm grip, claw grip, fingertip grip) and their…
A: The way you grip a computer mouse can significantly impact your comfort and control during extended…
Q: [Scheduling Algorithm Name:] [Arrival Times (only for PS algorithm)] [A textual presentation of the…
A: Import necessary Java libraries (ArrayList, Collections, List, and Random).Define a task class to…
Q: Discuss the importance of subnetting in IP addressing and provide an example of subnetting a…
A: Subnetting is the practice of dividing a large IP network into smaller, more manageable sub networks…
Q: What are macOS virtual desktops, and how can they enhance productivity and organization? Explain how…
A: MacOS virtual desktops, often referred to as "Spaces," are a feature that allows users to create and…
Q: Describe the process of establishing a secure SSL/TLS connection.
A: Establishing a secure SSL/TLS (Secure Sockets Layer/Transport Layer Security) connection is a…
Q: Describe the role of the Finder in file management and navigation on MacOS.
A: The Finder is a fundamental and integral component of the macOS operating system, designed to manage…
Q: Given an array A = [10, 7, 4, 2, 1], and target = 7, return the index of the target if found, else…
A: Yes, this problem can be solved in O(logN) time complexity using a binary search since the input…
Q: Describe the operation and significance of ARP (Address Resolution Protocol) in local networks. How…
A: A network protocol is a collection of guidelines that control the format, transmission, reception,…
Q: One of these can be solved using Djikstras algorithm Single source shortest path All source shortest…
A: Dijkstra's algorithm is defined as an algorithm to find the shortest paths between nodes or vertices…
Q: What is the OSI model, and how does it help in understanding network protocols? List the seven…
A: The Open Systems Interconnection (OSI) model is a conceptual model that describes how data is…
Q: Explore macOS server capabilities and services, including web hosting, file sharing, and remote…
A: macOS, Apple's operating system for Mac computers, is a versatile platform that can be used as a…
Q: Discuss the role of mouse acceleration and deceleration in fine-tuning cursor control.
A: In the field of computer science understanding mouse acceleration and deceleration is essential, for…
Q: Discuss the challenges and solutions related to network QoS (Quality of Service) and traffic…
A: In the area of networking, achieving a high level of Quality of Service (QoS) and effective traffic…
Q: Explain the concept of Quality of Service (QoS) in network protocols and how it impacts the…
A: In the realm of Computer Science and Networking, Quality of Service (QoS) plays a role. It…
Q: Discuss the challenges and advantages of implementing haptic feedback in computer mice.
A: Haptic feedback also called tactile feedback is a technology that supplies sensations through touch…
Q: Discuss the principles behind mouse input in the context of gaming and real-time applications.
A: Precision and responsive mouse input is critical in the fast-paced world of gaming and real-time…
Q: Explain the architecture and underlying technology of the macOS kernel, discussing how it manages…
A: In this question we have to understand about the architecture and underlying technology of the macOS…
Q: Match appropriate worst case time complexities Selection sort Merge sort Quick sort Binary search…
A: Worst-case time complexity is a measure of an algorithm's maximum running time under the least…
Q: Describe the core features and components of the macOS operating system.
A: macOS, the operating system developed by Apple Inc. for its Mac computers, is renowned for its…
Q: Discuss the role of polling rate in mouse control. How does a higher polling rate affect the…
A: 1) Polling rate, in the context of computer peripherals like mice, refers to the frequency at which…
Q: Describe the seven layers of the OSI model and provide a practical example for each layer's function
A: A computer network is a group of linked computers and other gadgets that may interact and share…
Q: Explain the significance of Gatekeeper in macOS for application security and how it works.
A: Gatekeeper is a crucial security feature in macOS designed to protect users from potentially harmful…
Q: Explore the role of customizable gaming mice in esports. How can advanced features like adjustable…
A: In computing, a mouse is an input or pointing device that is used to move a pointer on the screen to…
Q: How do different operating systems handle mouse input differently? Discuss the variations in mouse…
A: Operating systems, such as Windows, macOS, and Linux, each have unique ways of handling mouse input…
Q: Describe the DNS resolution process, including how a hostname is translated into an IP address, and…
A: Process for DNS Resolution:A distributed hierarchical system called the Domain Name System (DNS) is…
Q: Discuss the concept of "mouse polling rate" and its impact on precision and responsiveness. How can…
A: Precision: The accuracy and fine-grained control of the mouse cursor's motions are referred to as…
Q: Describe the role of ARP (Address Resolution Protocol) in a local network and how it works.
A: An IP (Internet Protocol) address is translated into a physical hardware address, often an Ethernet…
Q: Discuss the role of Gatekeeper in macOS and its importance in maintaining system security.
A: MacOS does not have a built-in component known as a "Gatekeeper" in the same way that, for example,…
Q: How does a touchpad on a laptop work, and what are the common gestures used for navigation?
A: Touchpads on laptops have become an essential element of our everyday computing experience,…
Q: What are the key components of a typical IT infrastructure, and how do they work together to support…
A: An organization’s IT infrastructure is a system made up of interconnected components that work…
Q: Discuss the role of ARP (Address Resolution Protocol) in networking and how it operates.
A: A network protocol is a collection of guidelines that control the format, transmission, reception,…
Q: Explain the role of the Finder in macOS and how users can effectively manage their files and…
A: In the macOS operating system, the Finder serves as the digital compass that guides users through…
Q: Discuss the evolution of mouse technology, from the ball-based mice to modern optical and wireless…
A: The evolution of mouse technology has played a role, in the development of computer…
Q: What is the role of a DHCP (Dynamic Host Configuration Protocol) server in a network, and how does…
A: The Dynamic Host Configuration Protocol (DHCP) is a network protocol that automates the process of…
Q: How does Time Machine work, and what is its purpose in macOS for backup and recovery?
A: Time Machine is a backup and recovery feature in macOS that is designed to provide users with an…
Q: Describe common network security protocols such as IPsec, SSL/TLS, and SSH. How do these protocols…
A: The process of putting safeguards in place to keep computer networks and data safe from intrusions,…
Q: Discuss the features and specifications that make a mouse suitable for gaming, including polling…
A: A mouse designed and optimized for gaming is known as a gaming mouse. It has a range of hardware and…
The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:
• The total number of sequences in the file
• The number of sequences that have the pattern CTATA
• The number of sequences that have more than 1000 bases
• The number of sequences that have over 50% GC composition
• The number of sequences that have more than 2000 bases and more than 50% GC
composition
Use python
Step by step
Solved in 5 steps with 3 images
- JAVA PPROGRAM Write a program that prompts the user to enter a file name, then opens the file in text mode and reads names. The file contains one name on each line. The program then compares each name with the name that is at the end of the file in a symmetrical position. For example if the file contains 10 names, the name #1 is compared with name #10, name #2 is compared with name #9, and so on. If you find matches you should print the name and the line numbers where the match was found. While entering the file name, the program should allow the user to type quit to exit the program. If the file with a given name does not exist, then display a message and allow the user to re-enter the file name. The file may contain up to 100 names. You can use an array or ArrayList object of your choosing, however you can only have one array or ArrayList. Input validation: a) If the file does not exist, then you should display a message "File 'somefile.txt' is not found." and allow the…The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAAThe file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcomposition
- INSTRUCTION: C++ Language Create a function that writes to a file named Inventy.txt the information of 8 items. Ask the user for the item's name, the item's quantity in storage, and the item's price and write it to the file. Create a function that reads the file and items' quantity and price to two different arrays. Create a function that computes the subtotal of each item. Implement all functions inside the main program and the computed value should be displayed with the item's name.C++ Create a program that reads a file containing a list of songs and prints the songs to the screen one at a time. After each song is printed, except for the last song, the program asks the user to press enter for more.After the last song, the program should say that this was the last song and quit.12 Digit Barcode In this homework, you will develop a python program which reads a series of barcodes from "barcodes.txt" and creates an output file "output.txt" which contains the barcodes and their status as seen in the example output below. 153182953420 5+1+2.5.4-1 7+3+8+4+3+2-3 1 23601057072 6+t-13 Even : 2+6+1 +5+0 = 14 Odd: 1+3+0+ 0 +7+7 = 18 3 x8 = 24 D+3- 10 4 + 4 = 8 10 -8 = 2 (CORRECT) What to submit: 1) ipynb file which contains checkBarcode function which takes a string varlable as input and returns true or false, and a driver program which reads in "barcodes.txt" and creates "output.txt". Assume the input file contains one barcode info per line. Important: Your input file name MUST BE "barcodes.txt" and the output file name MUST BE "output.txt". Otherwise, you'l get up to 30 pts penalty Below a sample output.txt: 123601057072 is a valid 10-digits barcode lab601057072 is an invalid 10-digits barcode 172601055072 is an invalid 10-digits barcode 12345 is an invalid 10-digits…
- PLEASE COMMENT CODE In a python program, create a new file and call it “ tracking”. Write to it four lines each contains information about an order like this: 1-00654-021 Dell charger Toronto-WEST 99-49-ZAD011-76540-022 ASUS battery Milton-EAST 34-56-CBH561-09239-026 HP HD Scarborough-NORTH 12-98-AZC451-12349-029 Mac FD North York-LAWRENCE 34-49-ZWL01Add the file two more lines: 1-34567-055 Lenovo SSD Milton-ON 34-09-MT04 1-90432-091 Lenovo battery Oakville-ON 78-KL98 Define a function that searches for a brand (e.g. Dell, ASUS, etc.). Test the function in your program.This Python Lab 9 Lab: Write a file copying program. The program asks for the name of the file to copy from (source file) and the name of the file to copy to (destination file). The program opens the source file for reading and the destination file for writing. As the program reads each line from the source file and it writes the line to the destination file. When every line from the source file has been written to the destination file, it close both files and print “Copy is successful.” In the sample run, “add.py” is the source file and “add-copy.py” is the destination file. Note that both “add-copy.py” is identical to “add.py” because “add-copy.py” is a copy of “add.py”. Sample run: Enter file to copy from: add.py Enter file to copy to : add-copy.py Copy is successful. Source file: add.py print("This program adds two numbers") a = int(input("Enter first number: ")) b = int(input("Enter second number: ")) print(f"{a} + {b} = {a+b}") Destination file:…. Convert the following pseudo code into assembly codo- (//' represents-comments). // Each element is 1 Byte long // Each element is 1 Byte long arrayl 13h, 14h, 15h, 16h array2 12h, 13h, 14h, 15h // lengthl is a Symbolic constant // length2 is a Symbolic constant // this variable is 1 byte long initialized with 30 lengthl = number of items in Arrayl. length2 = number of items in Array2 samplel = 30h sample2 = 5h. // this variable is 1 byte long 1 byte long variable maxlength = max of lengthl and length2. // maxlength is // this is a variable initialized with 0 index = 0. While ( If (arrayl [index] > array2[index] index < maxlength ){ * samplel) / (array2[index] expl = (arrayl[index] only store the quotient of the division in expl and expl is 7/16 bit long variable Sample2) else expl = 0 index = index + 1 }
- C-Programming Write a program that tells you how many words in a text file are unique (meaning the word only appears once in the text file). List of words in text file:…C++ Language : Write a program to write the numbers from 1 to 10 in a file called "test.txt" and then read the contents of same file and display it on screenPYTHON-Assume you have a file that has two columns separated by a comma. The first column contains gene accession numbers, and the second column contain their nucleotide sequence. For example: ABC123, AAGTCTTCCCTAAGCCC... KHJ456, TTCGGTCATACTATTC... NMG789, GCTACTCGATGCTA.... .... The file can contain any number of rows. Write a program that reads in this file (you can create one to test your code with, use TextEdit or Notepad) and creates a dictionary, where the keys are the accession numbers and the values are the sequences. Print out to the screen the dictionary pairs that you created.