Write a few statements that open a file called "words" and writes the last word in the file to a file called "lastword".
Q: In Python, Use num.txt file (below). create a program that opens num.txt, a file consisting of a…
A: I give the code in Python along with output and code screenshot
Q: Create a program that reads in a word from the user and counts the number of occurrences of that…
A: The code snippet in C++://header…
Q: Modify the program from this section so that the user can supply the interest rate. For very small…
A: while(balance < TARGET && year < 20) -> Until any one of the two conditions-…
Q: Write a Java program that: Reads a file Counts the number of lines Counts the number of words…
A: Write a Java program that will find the following things: Counts the number of lines Counts the…
Q: Java: Write a program to read first 50 characters from a file named “input.txt". Write those 50…
A: Program Approach: Create a class readwritefile. Create the main method. Create an instance of…
Q: I am doing a project that consists of creating a word scramble game with a text file where the…
A: Dear Student, The scramble function is given below, I have used random to shuffle the strings…
Q: In python -Once upon a time in the Land of Apples, John had three apples, Mary had five apples,…
A: The description is as- Taking 3 variables juan, maria, adan and storing 3,5,6 apples respectively.…
Q: Write a python program that extracts email messages and reads them from an mbox file. The program…
A: A python program that extracts email messages and reads them from an mbox file. In an mbox file we…
Q: Write a program that processes orders for our company Widgets and More. Your program will read the…
A: A required C++ program is as follows, //Include header files #include <iostream>…
Q: I am trying to figure out why the sum at the end of my Java code is not working correctly. It keeps…
A: import java.io.FileWriter; import java.io.File;import java.util.Scanner; public class Main{…
Q: Which of the following is not a file-reading method in Python?a) read b) readline c) readall d)…
A: Lets see the solution.
Q: Using JAVA Your client owns a bookstore, and they need to process an input file containing the…
A: Programming instructions: Include necessary header files. Create a class. In the class, Create a…
Q: or this task you are asked to write a program that will open a file called “story.txt” and count the…
A: Note: Since you have not provided the language to write the code so I am using Java language to…
Q: 2. Write a Java program that reads the file "input.txt" and writes all even values from this file…
A: The below code should solve your query. import java.io.File;import…
Q: Exercise in Python1 ###\n", "\n", "Open the text oneArt.txt, read the text line by line and, at the…
A: Hi there, Please find your solution below, I hope you would find my solution useful and helpful.…
Q: Complete the words program which opens the files specified on the command line and prints the file…
A: /* C++ program to count the number of words in text file */…
Q: Write a program that reads words from a text file and displays all the words (duplicates are not…
A: import java.util.*; import java.io.File; import java.io.FileNotFoundException; import…
Q: In python programming language, make a program that reads a file given as a command line argument.…
A: Here I have first of all used sys.argv() to extract the filename from the command line input Now I…
Q: In Python, Use the file named numbers.txt numbers.txt ——————- 10 25 36 45 89 42 54 —————— to create…
A:
Q: A company stores payment information for their employee working on a project and paid on a project…
A: We have to write a python program that is as follows:-
Q: Write a Java program that asks a user to input a text file name which contains no punctuations reads…
A:
Q: Write a python program that read a text file 'test.txt', shoud count and display the occurrence of…
A: Program Explanation: 1. User must specify a file name and the word to be searched.2. The file is…
Q: (InputMismatchException) Write a program that prompts the user to read two integers and display…
A: 1.crete a class main.2. take input from user.3. take first and the second number which is to be…
Q: The lines below are the content of the file named tyries.txt Baby shark doo doo doe doo doo doo Baby…
A: Based on python
Q: Write Python code that will open a file named aboutme.txt and write your name to the first line in…
A: To open a file named aboutme.txt and write your name to the first line in the file and your age (as…
Q: read a file and print it in console using input stream in java and write a program for that
A: program : // Java program to demonstrate BufferedReaderimport java.io.BufferedReader;import…
Q: Output to a file can be achieved with a _____ object, which is constructed with a File and has the…
A: The correct answer is "setOut", i.e. System.setOut.
Q: Write a java program that reads a file named input.txt and writes a file that contains the same…
A: Code import java.io.BufferedReader;import java.io.FileReader;import java.io.FileWriter;import…
Q: Write a program that will read the contents of "essay.txt" and copy all the lower case letters into…
A: // C code given Below
Q: Write a complete java program that: asks the user for a filename tests whether the file exists and…
A: Step 1 : Start Step 2 : In the main method , Take user input for the File Name and Opening the File…
Q: It is in java(we use netbeans) Use notepad to create a text file with weather information as…
A: Java is a high level programming language . And also object oriented. It is a platform for…
Q: Write only code according to this I don’t need output only code for this same
A: C++ used to answer this question
Q: Write a python program that read a text file 'count.txt', and should count and display the…
A: Please find the answer below
Q: he program will read and store the bad words(Kill,killer,assault,etc.) from the file. Then, it will…
A: code : ProfanityChecker.java import java.io.BufferedReader;import java.io.File;import…
Q: Write a method that takes a celsius input from user and converts given value to other units of…
A:
Q: te a complete Python program that opens a file called sample.txt for reading, and opens a file…
A: It is defined as a general-purpose, high-level, simple but effective object-oriented programming…
Q: 1. Write a Java program that reads the file "input.txt" and calculates and prints the average of all…
A: import java.io.*;public class Main{ public static void main(String[] args) throws IOException…
Q: Create an input text file that has the name input.txt with the following content. In Java please. 10…
A: import java.io.File; // Import the File classimport java.io.IOException; // Import the IOException…
Q: We will ask you and your classmates to write on the whiteboard the number of kids your immediate…
A: Python code: f=open("n_kids.txt","r")l=[]while f: n=f.readline() if(n==""): break…
Q: Write a complete java program that: asks the user for a file name tests whether the file exists and…
A: The program is written in Java. Check the program screenshot for the correct indentation. Please…
Q: I am trying to figure out why the sum at the end of my Java code is not working correctly. It keeps…
A: the answer is given below:-
Q: (B) Write Java Application to generate a digital signature for "Your Name in English followed by…
A: Digital Signature DefinitionDigital Signature is a technique for ensuring: Integrity: the message…
Q: What is the difference between declaring a header file with and ” “?
A: Introduction: The declarations are made in a header file, and then the #include directive is used in…
Q: Write a program that reads data from a file containing integers that ends with -999. Output the…
A: import java.util.*;import java.io.*;class Test171 { public static void main(String args[]) throws…
Q: Using Java PrintWriter, write a program that prompts the user for information and saves it to a text…
A: PrintWriter class The PrintWriter class from the java.io package is used for writing output data…
Q: What should be the name of the this Java File ?
A: Let us see the details below,
Q: Create an associative container to store movie names and ratings. Add a few films to the container.…
A: Associative Containers can be implemented using Map
Q: Write a complete java program that: asks the user for a file name tests whether the file exists and…
A: To do: java program that: asks the user for a file name tests whether the file exists and tells…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- When you open a file for reading, what happens if the file does not exist? When you open a file for writing, what happens if the file already exists?Here are the two programs which you may choose from to do this program: 1. Using Files - Student Line Up Modify the Student Line Up program described in Programming Challenge 14 which states: "A teacher has asked all of her students to line up according to their first name. For example, in one class Amy will at the front of the line, and Yolanda will be at the end. Write a program that prompts the user to enter the number of students in the class, then loops to read that many names. Once all of the names have been read, it reports which student would be at the front of the line and which one would be at the end of the line. You may assume that no two students have the same name. You are now to do this program reading names from a file. Names should be read in until there is no more data to be read. I am providing for you a file named LineUp.txt for you to use in writing this program. I suggest that you write it first without the file and then modify to add the file.Using Java: A hotel salesperson enters sales in a text file. Each line contains the following, separated by semicolons: the name of the client the service sold ( Dinner, Conference, Lodging) the amount of the sale the date of the event. Write a program that reads such a file and displays the total amount of each service category. Display an error if the file does not exist or the format is incorrect.
- 9. There are n students in a class. The instructor has a file which contains the students' names and grades for the last exam. The instructor would like to know the average of all scores. Please draw a flowchart which finds the average of the exam grades. Hint-You will need an accumulator and a count as you iterate through the list of students.The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionUse pythonENGAGE MINDTAP -Using a Counter-Controlled while Loop in Java Using a Counter-Controlled while Loop ? Summary In this lab, you use a counter-controlled while loop in a Java program provided for you. When completed, the program should print the numbers 0 through 10, along with their values multiplied by 2 and by 10. The data file contains the necessary variable declarations and some output statements. Instructions 1. Ensure the file named Multiply.java is open. 2. Write a counter-controlled while loop that uses the loop control variable to take on the values O through 10. Remember to initialize the loop control variable before the program enters the loop. 3. In the body of the loop, multiply the value of the loop control variable by 2 and by 10. Remember to change the value of the loop control variable in the body of the loop. 4. Execute the program by clicking Run. Record the output of this program. Grading When you have completed your program, click the Submit button to record your…
- The file “dna.seq” (on Blackboard) consists of several DNA sequences. Write a program that reads in the file “dna.seq” and counts the number of sequences with the following properties:• The total number of sequences in the file• The number of sequences that have the pattern CTATA• The number of sequences that have more than 1000 bases• The number of sequences that have over 50% GC composition• The number of sequences that have more than 2000 bases and more than 50% GCcompositionIn C++ (don't copy paste the same answer that is already on this site, post unique code) Structures A menu-driven program gives the user the option to find statistics about different baseball players. The program reads from a file and stores the data for ten baseball players, including player’s team, name of player, number of homeruns, batting average, and runs batted in. (You can make up your data, or get it online ) Write a program that declares a struct to store the data for a player. Declare an array of 10 components to store the data for 10 baseball players. The program prints out a menu (in a loop, so this can be done again and again) giving the user a choice to: print out all users and statistics print out the statistics for a specific player print out all data for a specific team update the data for a particular player (change one of the statistics) DO ALL WORK IN FUNCTIONS. USE A FUNCTION TO READ THE DATA, A FUNCTION TO PRINT THE MENU, and FUNCTIONS FOR EACH OF THE MENU…The file "dna.seq" (on Blackboard) consists of several DNA sequences. Write a program that reads in the file "dna.seq” and counts the number of sequences with the following properties: • The total number of sequences in the file • The number of sequences that have the pattern CTATA • The number of sequences that have more than 1000 bases • The number of sequences that have over 50% GC composition • The number of sequences that have more than 2000 bases and more than 50% GC composition Some program requirements: (1) the program should prompt the user for the filename. (2) each of the above tasks should be its own function. dna seg file = CAAAGATTAAGCCATGCATGTCTAAGTATAAGCAATTATACCGCGAAACTGCGAATGGOTCATTAAATCACT TATCGTTTATTTGATAGTACCTTACTACATGGATAACCGTGGTAATTCTAGAGOTAATACATGOTAAAAAGO CCGACTCACGGAGGGTTGTATTTATTAGATTAAAAA
- Using Java PrintWriter, write a program that prompts the user for information and saves it to a text file File name is musicians.txt Use this information below: George,Thoroughgood,54321 Ludwig,Van Beethoven,90111 Edward,Van Halen,12345 The fields below repeat for each customer: o Customer name (String)o Customer ID (numeric integer) o Bill balance (numeric)o EmailAddress (String)o Tax liability (numeric or String) The customers served by the office supply store are of two types: tax-exempt or non-tax- exempt. For a tax-exempt customer, the tax liability field on the file is the reason for the tax exemptions: education, non-profit, government, other (String). For a non-tax exempt customer, the tax liability field is the percent of tax that the customer will pay (numeric) based on the state where the customer’s business resides. Program requirements: From the information provided, write a solution that includes the following: A suitable inheritance hierarchy which represents the customers serviced by the office supply company. It is up to you how to design the inheritance hierarchy. I suggest a Customer class and appropriate subclasses.. For all classes include the following: o Instance variables o…Can i get help writing this program in c++ on microsoft visual 19 with this input file incorporated. The client should read in the file contents and store them in the object. The file will be formatted such that the first line contains the month name, the second line contains the year, and each successive line contains a temperature. A typical input file might contain: June 2019 90 85 97 91 87 86 88 82 83 85